RAIDD (CRADD) (NM_003805) Human 3' UTR Clone

CAT#: SC206690

3`UTR clone of CASP2 and RIPK1 domain containing adaptor with death domain (CRADD) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CRADD"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CRADD
Synonyms MRT34; RAIDD
ACCN NM_003805
Insert Size 501
Sequence Data
>SC206690 3'UTR clone of NM_003805
The sequence shown below is from the reference sequence of NM_003805. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCCTGCACATGTTGGAGTGATGGTGCCTCCAGCAACCGCTGGGGAGTGTGTCCCTGAGTCATGTGGGCTG
AATCCTGACTTTCACTCAGAGCAGGTGGTTTTTTGTGTAGGTTTGTTTTTTATTTTTGATGATCTTCAGA
TGGAAGGAGAAAACAGGGTTTCCACTAGACATTACTTGAAAGGCCAGATTACTCAGCAGATCTCCCATGT
TGGCTCAACAATTCTTTGTTTTTAATTGCTTGAAGATTGCATTGTTGTAATTGTTCAGTTTTTAAATGTG
TAATGGCATTTTAATAGACTAGTAAATCACAGTGGTTCAAAATATATATCCATATATATATATATCCATA
TATATATCTCATGTCATCACATTACAGGCAGGTGTCTCATATGTAAAACATTTACCTGAATGTTGTCTGA
GGACTGAACTGTGGACTTTACTATTCATAATGATAAAATAATAAAATGCGAATTACTATATATAATGTGC
CTCACTCATGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003805.3
Summary This gene encodes a protein containing a death domain (DD) motif. This protein recruits caspase 2/ICH1 to the cell death signal transduction complex, which includes tumor necrosis factor receptor 1 (TNFR1A) and RIPK1/RIP kinase, and acts in promoting apoptosis. A mutation in this gene was associated with cognitive disability. A related pseudogene is found on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Locus ID 8738

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.