PAK3 (NM_001128168) Human 3' UTR Clone

CAT#: SC206716

3`UTR clone of p21 protein (Cdc42/Rac)-activated kinase 3 (PAK3) transcript variant 4 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PAK3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PAK3
Synonyms ARA; beta-PAK; bPAK; MRX30; MRX47; OPHN3; PAK-3; PAK3beta
ACCN NM_001128168
Insert Size 492 bp
Sequence Data
>SC206716 3'UTR clone of NM_001128168
The sequence shown below is from the reference sequence of NM_001128168. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAGAACAGCAGCCGCTAAGACTGCAAGCCTTACACCTCACCATCTCCCTCATGAGTAAGACTGAAATAAA
ACTCTGCTGCAGGAAAGATGGAAGAAAAGACAGTCAAATGGGGTGGGGGTTCTTTACCTTTCAAATGAAT
AGAAACTTCTTATAAGCCTTTTTCCTACTCCCTCAGATTATGTAATTTATTTGTAAGCCTGAATCGCAGC
CCAAACAGGGCAGCAATGTTGAAGTGACCATAAAGTGGTCACTTCCACCGTGAAGCGAAAGAGCCAGTAG
TGAATCCCCTCATTTTGTGCATTCACTTTGAAGAAAAAGGTTTCTCAAAGATGCACACTCCCTCTTCATA
GTGTTGTGTTTGTTTTTAAGTTAGAGAGTAGTCCCTCTTGCATTCAAACCTCCTTCAAAACTCCTTACCC
AATGTGATGTTTTTCACTTGCATTGTCATTAGATGTCCAGAAAAAAAAAAGATGTCAAAATGTTTTTCTA
AA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001128168.1
Summary 'The protein encoded by this gene is a serine-threonine kinase and forms an activated complex with GTP-bound RAS-like (P21), CDC2 and RAC1. This protein may be necessary for dendritic development and for the rapid cytoskeletal reorganization in dendritic spines associated with synaptic plasticity. Defects in this gene are the cause of a non-syndromic form of X-linked intellectual disability. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2017]'
Locus ID 5063

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.