MMP1 (NM_001145938) Human 3' UTR Clone

CAT#: SC206763

3`UTR clone of matrix metallopeptidase 1 (interstitial collagenase) (MMP1) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MMP1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MMP1
Synonyms CLG; CLGN
ACCN NM_001145938
Insert Size 516 bp
Sequence Data
>SC206763 3'UTR clone of NM_001145938
The sequence shown below is from the reference sequence of NM_001145938. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TAGCTGGTTCAACTGCAGGAAAAATTGAACATTACTAATTTGAATGGAAAACACATGGTGTGAGTCCAAA
GAAGGTGTTTTCCTGAAGAACTGTCTATTTTCTCAGTCATTTTTAACCTCTAGAGTCACTGATACACAGA
ATATAATCTTATTTATACCTCAGTTTGCATATTTTTTTACTATTTAGAATGTAGCCCTTTTTGTACTGAT
ATAATTTAGTTCCACAAATGGTGGGTACAAAAAGTCAAGTTTGTGGCTTATGGATTCATATAGGCCAGAG
TTGCAAAGATCTTTTCCAGAGTATGCAACTCTGACGTTGATCCCAGAGAGCAGCTTCAGTGACAAACATA
TCCTTTCAAGACAGAAAGAGACAGGAGACATGAGTCTTTGCCGGAGGAAAAGCAGCTCAAGAACACATGT
GCAGTCACTGGTGTCACCCTGGATAGGCAAGGGATAACTCTTCTAACACAAAATAAGTGTTTTATGTTTG
GAATAAAGTCAACCTTGTTTCTACTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001145938.1
Summary 'This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This secreted protease breaks down the interstitial collagens, including types I, II, and III. The gene is part of a cluster of MMP genes on chromosome 11. Mutations in this gene are associated with chronic obstructive pulmonary disease (COPD). Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]'
Locus ID 4312

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.