CARD11 (NM_032415) Human 3' UTR Clone

CAT#: SC206777

3`UTR clone of caspase recruitment domain family member 11 (CARD11) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CARD11
• Synonyms: BENTA; BIMP3; CARMA1; IMD11; IMD11A; PPBL
• ACCN: NM_032415
• Insert Size: 515
• Sequence Data:
  Insert Sequence

  >SC206777 3'UTR clone of NM_032415
  The sequence shown below is from the reference sequence of NM_032415. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCAGCGCAAGACCATCTGGGTGGACGAGGACCAGCTGTGAGGCGGGCGCCCTGGGCAGAGAGACTCTGT
  GGCGCGGGGCATCCTATGAGGCAGGCACCCTGGGCAGAGAGATGCAGTGGGTGCGGGGGGATCCTGTGGC
  CCACAGAGCTGCCCCAGCAGACGCTCCGCCCCACCCGGTGATGGAGCCCCGGGGGGACAGTCGTGCCTGG
  GGAGGAGCAGGGTACAGCCCATTCCCCCAGCCCTGGCTGACCTGGCCTAGCAGTTTGGCCCTGCTGGCCT
  TAGCAGGGAGACAGGGGAGCAAAGAACGCCAAGCCGGAGGCCCGAGGCCAGCCGGCCTCTCGAGAGCCAG
  AGCAGCAGTTGAATGTAATGCTGGGGACAGGCATGCTGCCGCCAGTAGGGCGGGGACCCGGACAGCCAGG
  TGACTACCAGTCCTGGGGACACACTCACCATAAACACATCCCCAGGCAGGACAGATCGGGGAAGGGGTGT
  GTACCAGGCTATGATTTCTCTTGCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_032415.3
• Summary: The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
• Locus ID: 84433