B4GALT3 (NM_003779) Human 3' UTR Clone

CAT#: SC206813

3`UTR clone of UDP-Gal:betaGlcNAc beta 14- galactosyltransferase polypeptide 3 (B4GALT3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: B4GALT3
• Synonyms: beta4Gal-T3
• ACCN: NM_003779
• Insert Size: 551
• Sequence Data:
  Insert Sequence

  >SC206813 3'UTR clone of NM_003779
  The sequence shown below is from the reference sequence of NM_003779. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCTCTATCTACTGCCAACCACACAGCCCTCCGAGGTTCACACTGACTCCTCCTTCCTGTCTACCTTAAT
  CATGAAACCGAATTCATGGGGTTGTATTCTCCCCACCCTCAGCTCCTCACTGTTCTCAGAGGGATGTGAG
  GGAACTGAACTCTGGTGCCGTGCTAGGGGGTAGGGGCCTCTCCCTCACTGCTGGACTGGAGCTGGGCTCC
  TGTAGACCTGAGGGGTCCCTCTCTCTAGGGTCTCCTGTAGGGCTTATGACTGTGAATCCTTGATGTCATG
  ATTTTATGTGACGATTCCTAGGAGTCCCTGCCCCTAGAGTAGGAGCAGGGCTGGACCCCAAGCCCCTCCC
  TCTTCCATGGAGAGAAGAGTGATCTGGCTTCTCCTCGGACCTCTGTGAATATTTATTCTATTTATGGTTC
  CCGGGAAGTTGTTTGGTGAAGGAAGCCCCTCCCTGGGCATTTTCTGCCTATGCTGGAATAGCTCCCTCTT
  CTGGTCCTGGCTCAGGGGGCTGGGATTTTGATATATTTTCTAATAAAGGACTTTGTCTCGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003779.2
• Summary: This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
• Locus ID: 8703