Kallikrein 15 (KLK15) (NM_017509) Human 3' UTR Clone

CAT#: SC206827

3`UTR clone of kallikrein-related peptidase 15 (KLK15) transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KLK15
• Synonyms: ACO; HSRNASPH
• ACCN: NM_017509
• Insert Size: 524
• Sequence Data:
  Insert Sequence

  >SC206827 3'UTR clone of NM_017509
  The sequence shown below is from the reference sequence of NM_017509. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTACTTGGAGTGGATCAGGGAAACCATGAAGAGGAACTGACTATTCTAGCCTATCTCCTGTGCCCCTGAC
  TGAGCAGAAGCCCCCACAGCTGGCCAGCAGCCCCGCCTGACATGGAACAGAACGGAGCCATCCCCCAAGA
  CCCTGTCCAAGGCCCAGATGTTAGCCAAGGACTTGTCCCACCTGAGGACAAAGCTGGCGCTCAAGGTCAC
  CTGTTTAATGCCAAGATAACAAAGCGCTGATCCAAGTTGCTCTGTAGGAATTTCTGTGACTTTTTTCTGG
  GGTCAAAGAGAAACCCCGAGACACTGTACACTGTTCCTTTTCACCCACCACCCCGATCCCTAGGTGAGGA
  GAAGCGGCTTGAAGCAGGGCTCCATTCATTCAACACACATGACCACCCGTGTGATCTTGAACAAGAGGCC
  CAATCTCACTTCGCCTTGGTTTCCTTATCTGTAAAATGAGACCATCTTATTGCTGACTTCAAAGGGCTGT
  TGTGAGGATTAAATGAGATGATTCGTCTGAACTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_017509.2
• Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In prostate cancer, this gene has increased expression, which indicates its possible use as a diagnostic or prognostic marker for prostate cancer. The gene contains multiple polyadenylation sites and alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
• Locus ID: 55554