TRAF3 (NM_003300) Human 3' UTR Clone

CAT#: SC206836

3`UTR clone of TNF receptor-associated factor 3 (TRAF3) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

5 Days*

Size
    • 10 ug

Product Images

Other products for "TRAF3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TRAF3
Synonyms CAP-1; CAP1; CD40bp; CRAF1; IIAE5; LAP1; RNF118
ACCN NM_003300
Insert Size 531 bp
Sequence Data
>SC206836 3'UTR clone of NM_003300
The sequence shown below is from the reference sequence of NM_003300. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GATACTTCGGATCTGCCCGATCCCTGATAAGTAGCTGGGGAGGTGGATTTAGCAGAAGGCAACTCCTCTG
GGGGATTTGAACCGGTCTGTCTTCACTGAGGTCCTCGCGCTCAGAAAAGGACCTTGTGAGACGGAGGAAG
CGGCAGAAGGCGGACGCGTGCCGGCGGGAGGAGCCACGCGTGAGCACACCTGACACGTTTTATAATAGAC
TAGCCACACTTCACTCTGAAGAATTATTTATCCTTCAACAAGATAAATATTGCTGTCAGAGAAGGTTTTC
ATTTTCATTTTTAAAGATCTAGTTAATTAAGGTGGAAAACATATATGCTAAACAAAAGAAACATGATTTT
TCTTCCTTAAACTTGAACACCAAAAAAACACACACACACACACACGTGGGGATAGCTGGACATGTCAGCA
TGTTAAGTAAAAGGAGAATTTATGAAATAGTAATGCAATTCTGATATCTTCTTTCTAAAATTCAAGAGTG
CAATTTTGTTTCAAATACAGTATATTGTCTATTTTTAAGGC

CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-RsrII     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_003300.2
Summary 'The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. The protein also plays a role in the regulation of antiviral response. Mutations in this are associated with Encephalopathy, acute, infection-induced, herpes-specific 5. [provided by RefSeq, Jul 2020]'
Locus ID 7187

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.