Dihydropyrimidinase (DPYS) (NM_001385) Human 3' UTR Clone

CAT#: SC206849

3`UTR clone of dihydropyrimidinase (DPYS) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DPYS
• Synonyms: DHP; DHPase
• ACCN: NM_001385
• Insert Size: 475 bp
• Sequence Data:
  Insert Sequence

  >SC206849 3'UTR clone of NM_001385
  The sequence shown below is from the reference sequence of NM_001385. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAAGATGCCACAGCAGGGACCAGGAAACAGGCCCACCCCTGAAGTGTGTGCCATCGGTAAAAAAATCAG
  AGGAAAGGAGGCTGCCATTCCCTTCACAGCCAAACATTGTCAACCCATGGAGAAGCAGGCCTTATTCAAC
  TCCCTAGGATCCTTTAGAAAAAATTCACCACTATAGGCTTCTTTGATTTTCTTTCAGAAGCAATTGCTGT
  CTTTCTCACTGTGTTTTTGTTGCTGCATAAGATTGAAGGTATAAATTTATATTATTGTGATGGAAAGGCT
  GTGTGGAAATTCATTGATGATACTTTAAAATGTCATCTTTGCTTGTACTAGATTTCTTACTTAGAATTTT
  TAAAAATCATTTTCTTGTTTAAATAGTTTCTTTTTTTAAAAAAATGGTTACATTAGTTTTAAAATAGCTC
  TGTGATTTTACTTTTTATTGTAATTAATAAACATTGAGATCTTCATTTTATACCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001385.2
• Summary: 'Dihydropyrimidinase catalyzes the conversion of 5,6-dihydrouracil to 3-ureidopropionate in pyrimidine metabolism. Dihydropyrimidinase is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria. [provided by RefSeq, Jul 2008]'
• Locus ID: 1807