TOR2A (NM_001085347) Human 3' UTR Clone

CAT#: SC206869

3`UTR clone of torsin family 2 member A (TOR2A) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TOR2A
• Synonyms: TORP1
• ACCN: NM_001085347
• Insert Size: 528
• Sequence Data:
  Insert Sequence

  >SC206869 3'UTR clone of NM_001085347
  The sequence shown below is from the reference sequence of NM_001085347. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAATCGCCTTCTTCCTCTGACTCTCTGAGTGGTGTCCTCGGCCCCCCTGATGGCCAGGCCATGCAGGAAA
  GGCCAGGGGCCTCTGTCACAGGAACCCAGAGCACCAAGTGAGATGAACGGAGTGTCGGCTAGGCCACGGG
  ACAGATGGCCAGGAAGGGCCCTGGCCTCTAAACTGGCTCGAGAGCATCTTGGCCCCGGCCACCTTCCCCA
  GGGAAACCCCTGGTCACCCCAGAACCTCACTGAGCCTTGACCTCCCCCTGCAGCCTGAGCCTTCTTACTG
  TGAATTATAACTCAGGGACTGTGGCTCGTGGCGGTGCTCCCTCCTCAGTCTGCCACCCTTGCCCCTTGCC
  TCCTTGGTCGGGCACCATACCTCCTCCCCTCCACCCCACACCCTGTGTCCATATCAAGCCAGGTGGAGCC
  TTCTCAGTTTCCAGAAATGGAGGGACTCAAGCTGCCACTTGGGCCTGGTTTTAGATGTTTTTAATTTTGT
  AAAAGAAAACAAGTATAATAAACTCAGCTGTGGGACCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001085347.1
• Summary: This gene encodes a member of the AAA family of adenosine triphosphatases with similarity to Clp proteases and heat shock proteins. Alternative splicing at this locus results in the translation of multiple isoforms of the encoded protein, some of which contain salusin peptides in the C-terminal region. These peptides may play roles in hypotension, myocardial growth and the induction of mitogenesis, and may also be involved in the pathogenesis of atherosclerosis. The antimicrobial peptide salusin-beta has antibacterial activity. [provided by RefSeq, Nov 2014]
• Locus ID: 27433