KIR2DL1 (NM_014218) Human 3' UTR Clone

CAT#: SC206905

3`UTR clone of killer cell immunoglobulin-like receptor two domains long cytoplasmic tail 1 (KIR2DL1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KIR2DL1
• Synonyms: CD158A; KIR-K64; KIR2DL3; KIR221; NKAT; NKAT-1; NKAT1; p58.1
• ACCN: NM_014218
• Insert Size: 528 bp
• Sequence Data:
  Insert Sequence

  >SC206905 3'UTR clone of NM_014218
  The sequence shown below is from the reference sequence of NM_014218. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAAATGCTGAGTCCAGATCCAAAGTTGTCTCCTGCCCATGAGCACCACAGTCAGGCCTTGAGGGCGTCT
  TCTAGGGAGACAACAGCCCTGTCTCAAAACCGGGTTGCCAGCTCCCATGTACCAGCAGCTGGAATCTGAA
  GGCGTGAGTCTGCATCTTAGGGCATCGATCTTCCTCACACCACAAATCTGAATGTGCCTCTCTCTTGCTT
  ACAAATGTCTAAGGTCCCCACTGCCTGCTGGAGAAAAAACACACTCCTTTGCTTAACCCACAGTTCTCCA
  TTTCACTTGACCCCTGCCCACCTCTCCAACCTAACTGGCTTACTTCCTAGTCTACTTGAGGCTGCAATCA
  CACTGAGGAACTCACAATTCCAAACATACAAGAGGCTCCCTCTTAACGCAGCACTTAGACACGTGTTGTT
  CCACCTTCCCTCATGCTGTTCCACCTCCCCTCAGACTAGCTTTCAGTCTTCTGTCAGCAGTAAAACTTAT
  ATATTTTTTAAAATAACTTCAATGTAGTTTTCCATCCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_014218.2
• Summary: 'Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008]'
• Locus ID: 3802