UGT2B15 (NM_001076) Human 3' UTR Clone

CAT#: SC206913

3`UTR clone of UDP glucuronosyltransferase 2 family polypeptide B15 (UGT2B15) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UGT2B15
• Synonyms: HLUG4; UDPGT 2B8; UDPGT2B15; UDPGTH3; UGT2B8
• ACCN: NM_001076
• Insert Size: 553 bp
• Sequence Data:
  Insert Sequence

  >SC206913 3'UTR clone of NM_001076
  The sequence shown below is from the reference sequence of NM_001076. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTTTCCGAAAGCTTGCCAAAAAAGGAAAGAAGAAGAAAAGAGATTAGTTATATCAAAAGCCTGAAGTGGA
  ATGACTGAAAGATGGGACTCCTCCTTTATTTCAGCATGGAGGGTTTTAAATGGAGGATTTCCTTTTTCCT
  GTGACAAAACATCTTTTCACAACTTACCTTGTTAAGACAAAATTTATTTTCCAGGGATTTAATACGTACT
  TTAGCTGAATTATTCTATGTCAATGATTTTTAAGCTATGAAAAATACAATGGGGGGAAGGATAGCATTTG
  GAGATATACCTAATGTTAAATGACGAGTTACTGGATGCAGCACGCCAACATGGCACATGTATACATATGT
  AGCTAACCTGCACGTTGTGCACATGTACCCTAAAACTTAAAGTATAATTTAAAAAAAGCAAAAAAAAAAA
  ATACAACTCTTTTTTTTAAACCAGGAAGGAAAATGTGAACATGGAAACAACTTCTAGTATTGGATCTGAA
  AATAAAGTGTCATCCAAGCCATAAAAAAAAAAGAAAAGAAAAATAAAAATAATATAAAACCTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001076.2
• Summary: 'This gene encodes a glycosyltransferase that is invovled in the metabolism and elimination of toxic compounts, both endogenous and of xenobiotic origin. This gene plays a role in the regulation of estrogens and androgens. This locus is present in a cluster of similar genes and pseudogenes on chromosome 4. [provided by RefSeq, Aug 2016]'
• Locus ID: 7366