Estrogen Receptor beta (ESR2) (NM_001040276) Human 3' UTR Clone

CAT#: SC206929

3`UTR clone of estrogen receptor 2 (ER beta) (ESR2) transcript variant c for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ESR2
• Synonyms: ER-BETA; Erb; ESR-BETA; ESRB; ESTRB; NR3A2
• ACCN: NM_001040276
• Insert Size: 525 bp
• Sequence Data:
  Insert Sequence

  >SC206929 3'UTR clone of NM_001040276
  The sequence shown below is from the reference sequence of NM_001040276. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTGCCTGAAGCAACGATGGAGCAGTGACCCTCTAATCAACTCGGTGGCCTAAAGAAAAATCTTGGGTAAC
  ATTTTCACTTCAGTTTCCCTCTGGGATCATTGTAATCCATGAAAAAAATAATTTTAAAGAAAGAGTTAAA
  ATACTTTGAAGTTAGTTATGTGGTTAAAAACCACCTTCCTTTCTATTATCAATCCAACAATTTGATAACT
  GTAAACGCTAAAGTGAAGACGGATTCTCTTCAGATGGTCTCCTTAACTGCCCAGGGCTTGCAGATGTCTC
  ACCCATGAGGGGCACCAATGTAGAAAGCTGAGGCTTCATCTACTGATGAGCTTCACTGGTTTCCCCTGAG
  GTTTGTGCTTTGGCAGAGAAGGGGAGGAGGGGACTGGGATTGTGTGGTCAGCTGTGCCTGCCAACAGATG
  CAGGTTAGGAACTGTGTTCAGTATCTTCCAATAAGAAAGGGGAAATGCCGATGCCTATCCTCTTTGTTTA
  GGTAGAAAGTAAAATGCTACTGGACTTAAATGGGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001040276.1
• Summary: 'This gene encodes a member of the family of estrogen receptors and superfamily of nuclear receptor transcription factors. The gene product contains an N-terminal DNA binding domain and C-terminal ligand binding domain and is localized to the nucleus, cytoplasm, and mitochondria. Upon binding to 17beta-estradiol or related ligands, the encoded protein forms homo- or hetero-dimers that interact with specific DNA sequences to activate transcription. Some isoforms dominantly inhibit the activity of other estrogen receptor family members. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been fully characterized. [provided by RefSeq, Jul 2008]'
• Locus ID: 2100