HADHB (NM_000183) Human 3' UTR Clone

CAT#: SC206991

3`UTR clone of hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein) beta subunit (HADHB) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HADHB
• Synonyms: ECHB; MSTP029; MTPB; TP-BETA
• ACCN: NM_000183
• Insert Size: 536 bp
• Sequence Data:
  Insert Sequence

  >SC206991 3'UTR clone of NM_000183
  The sequence shown below is from the reference sequence of NM_000183. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCATGCTATGATAGTGGAAGCTTATCCAAAATAATAGATCCAGAAGAAGTGACCTGAAGTTTCTGTGCAA
  CACTCACACTAGGCAATGCCATTTCAATGCATTACTAAATGACATTTGTAGTTCCTAGCTCCTCTTAGGA
  AAACAGTTCTTGTGGCCTTCTATTAAATAGTTTGCACTTAAGCCTTGCCAGTGTTCTGAGCTTTTCAATA
  ATCAGTTTACTGCTCTTTCAGGGATTTCTAAGCCACCAGAATCTCACATGAGATGTGTGGGTGGTTGTTT
  TTGGTCTCTGTTGTCACTAAAGACTAAATGAGGGTTTGCAGTTGGGAAAGAGGTCAACTGAGATTTGGAA
  ATCATCTTTGTAATATTTGCAAATTATACTTGTTCTTATCTGTGTCCTAAAGATGTGTTCTCTATAAAAT
  ACAAACCAACGTGCCTAATTAATTATGGAAAAATAATTCAGAATCTAAACACCACTGAAAACTTATAAAA
  AATGTTTAGATACATAAATATGGTGGTCAGCGTTAATAAAGTGGAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000183.2
• Summary: 'This gene encodes the beta subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the beta subunit catalyzing the 3-ketoacyl-CoA thiolase activity. The encoded protein can also bind RNA and decreases the stability of some mRNAs. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. Mutations in this gene result in trifunctional protein deficiency. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]'
• Locus ID: 3032