Thymidylate Synthase (TYMS) (NM_001071) Human 3' UTR Clone

CAT#: SC207009

3`UTR clone of thymidylate synthetase (TYMS) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TYMS"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TYMS
Synonyms HST422; TMS; TS
ACCN NM_001071
Insert Size 546 bp
Sequence Data
>SC207009 3'UTR clone of NM_001071
The sequence shown below is from the reference sequence of NM_001071. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGTACAATCCGCATCCAACTATTAAAATGGAAATGGCTGTTTAGGGTGCTTTCAAAGGAGCTCGAAGGAT
ATTGTCAGTCTTTAGGGGTTGGGCTGGATGCCGAGGTAAAAGTTCTTTTTGCTCTAAAAGAAAAAGGAAC
TAGGTCAAAAATCTGTCCGTGACCTATCAGTTATTAATTTTTAAGGATGTTGCCACTGGCAAATGTAACT
GTGCCAGTTCTTTCCATAATAAAAGGCTTTGAGTTAACTCACTGAGGGTATCTGACAATGCTGAGGTTAT
GAACAAAGTGAGGAGAATGAAATGTATGTGCTCTTAGCAAAAACATGTATGTGCATTTCAATCCCACGTA
CTTATAAAGAAGGTTGGTGAATTTCACAAGCTATTTTTGGAATATTTTTAGAATATTTTAAGAATTTCAC
AAGCTATTCCCTCAAATCTGAGGGAGCTGAGTAACACCATCGATCATGATGTAGAGTGTGGTTATGAACT
TTAAAGTTATAGTTGTTTTATATGTTGCTATAATAAAGAAGTGTTCTGCATTCGTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001071.2
Summary 'Thymidylate synthase catalyzes the methylation of deoxyuridylate to deoxythymidylate using, 10-methylenetetrahydrofolate (methylene-THF) as a cofactor. This function maintains the dTMP (thymidine-5-prime monophosphate) pool critical for DNA replication and repair. The enzyme has been of interest as a target for cancer chemotherapeutic agents. It is considered to be the primary site of action for 5-fluorouracil, 5-fluoro-2-prime-deoxyuridine, and some folate analogs. Expression of this gene and that of a naturally occurring antisense transcript, mitochondrial enolase superfamily member 1 (GeneID:55556), vary inversely when cell-growth progresses from late-log to plateau phase. Polymorphisms in this gene may be associated with etiology of neoplasia, including breast cancer, and response to chemotherapy. [provided by RefSeq, Aug 2017]'
Locus ID 7298

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.