TTYH1 (NM_001005367) Human 3' UTR Clone

CAT#: SC207041

3`UTR clone of tweety homolog 1 (Drosophila) (TTYH1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TTYH1
• ACCN: NM_001005367
• Insert Size: 527 bp
• Sequence Data:
  Insert Sequence

  >SC207041 3'UTR clone of NM_001005367
  The sequence shown below is from the reference sequence of NM_001005367. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTCTTCGTTCCTTCCCTGGCTGCCGGAGGAGACCCCACTAACCCAGCCTGCCTGGGCTCTGACCACTAA
  CACTCTTGGCCATGGACAGCCTGCACAGGACCGCCTCCCTGCTCTTGGCCACTGTGCTCCCATTTCTGTC
  CTTGGCCTTGGGAGTAGCTGAGGGGGCAGACTAGGGAGTAGGGCTGGCAGGGGAGGGGGCAGACAGCCTC
  GCCTCGCACCCTTCATCCCTGGCTGCCGGTCCCATCCTTGGAGGGACTAAGCTGGGGGTGGGGGACATGA
  GTCCCCCTGCTGCCCCTGCCACATCCCAGTGGGCTCTGACCCCCTGATCTCAACTCGTGGCACTAACTTG
  GAAAAGGGTTGATTTAAAATAAAAGGGAAGACTATTTTACAAGCAGCTGGGTCCTCCTTATTTCTCCTCT
  CCCTTGATTCGGCCTCCTGGCCAGGGCTGGGACATCCTCCCTGCTGTCCTCTCTCCCCCGGCCTCCCAGC
  TGCCAGGAATTTCTGCGCCTGTCCAGGCTCAGCAAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001005367.1
• Summary: This gene encodes a member of the tweety family of proteins. Members of this family function as chloride anion channels. The encoded protein functions as a calcium(2+)-independent, volume-sensitive large conductance chloride(-) channel. Three transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jan 2011]
• Locus ID: 57348