Cofilin 1 (CFL1) (NM_005507) Human 3' UTR Clone

CAT#: SC207061

3`UTR clone of cofilin 1 (non-muscle) (CFL1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CFL1
• Synonyms: CFL; cofilin; HEL-S-15
• ACCN: NM_005507
• Insert Size: 510 bp
• Sequence Data:
  Insert Sequence

  >SC207061 3'UTR clone of NM_005507
  The sequence shown below is from the reference sequence of NM_005507. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGAGGGCAAGCCTTTGTGAGCCCCTTCTGGCCCCCTGCCTGGAGCATCTGGCAGCCCCACACCTGCCCT
  TGGGGGTTGCAGGCTGCCCCCTTCCTGCCAGACCGGAGGGGCTGGGGGGATCCCAGCAGGGGGAGGGCAA
  TCCCTTCACCCCAGTTGCCAAACAGACCCCCCACCCCCTGGATTTTCCTTCTCCCTCCATCCCTTGACGG
  TTCTGGCCTTCCCAAACTGCTTTTGATCTTTTGATTCCTCTTGGGCTGAAGCAGACCAAGTTCCCCCCAG
  GCACCCCAGTTGTGGGGGAGCCTGTATTTTTTTTAACAACATCCCCATTCCCCACCTGGTCCTCCCCCTT
  CCCATGCTGCCAACTTCTAACCGCAATAGTGACTCTGTGCTTGTCTGTTTAGTTCTGTGTATAAATGGAA
  TGTTGTGGAGATGACCCCTCCCTGTGCCGGCTGGTTCCTCTCCCTTTTCCCCTGGTCACGGCTACTCATG
  GAAGCAGGACCAGTAAGGGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005507.2
• Summary: 'The protein encoded by this gene can polymerize and depolymerize F-actin and G-actin in a pH-dependent manner. Increased phosphorylation of this protein by LIM kinase aids in Rho-induced reorganization of the actin cytoskeleton. Cofilin is a widely distributed intracellular actin-modulating protein that binds and depolymerizes filamentous F-actin and inhibits the polymerization of monomeric G-actin in a pH-dependent manner. It is involved in the translocation of actin-cofilin complex from cytoplasm to nucleus.[supplied by OMIM, Apr 2004]'
• Locus ID: 1072