BMAL1 (ARNTL) (NM_001030272) Human 3' UTR Clone

CAT#: SC207070

3`UTR clone of aryl hydrocarbon receptor nuclear translocator-like (ARNTL) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ARNTL
• Synonyms: bHLHe5; BMAL1; BMAL1c; JAP3; MOP3; PASD3; TIC
• ACCN: NM_001030272
• Insert Size: 545 bp
• Sequence Data:
  Insert Sequence

  >SC207070 3'UTR clone of NM_001030272
  The sequence shown below is from the reference sequence of NM_001030272. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCCTGTTGACTTTAGTGACTTGCCATGGCCGCTGTAAACACTACATGTTGCTTTGGCAACAGCTATAGT
  ATCAAAGTGCATTACTGGTGGAGTTTTACAGTCTGTGAAGCTTACTGGATAAGGAGAGAATAGCTTTTAT
  GTACTGACTTCATAAAAGCCATCTCAGAGCCATTGATACAAGTCAATCTTACTATATGTAACTTCAGACA
  AAGTGGAACTAAGCCTGCTCCAGTGTTTCCTCATCATTGATTATTGGGCTAGCTGTGGATAGCTTGCATT
  AATTGTATATTTTGGATTCTGTTTGTGTTGAATTTTTTAATCATTGTGCACAGAAGCATCATTGGTAGCT
  TTTATATGCAAATGGTCATTTCAGATGTATGGTGTTTTTACACTACAAAGAAGTCCCCCATGTGGATATT
  TCTTATACTAATTGTATCATAAAGCCGTTTATTCTTCCTTGTAAGAATCCTTTACTATAAATATGGGTTA
  AAGTATAATGTACTAGACAGTTAAATATTTTTAATAAATGTTTCCCTTGTTCTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001030272.1
• Summary: 'The protein encoded by this gene is a basic helix-loop-helix protein that forms a heterodimer with CLOCK. This heterodimer binds E-box enhancer elements upstream of Period (PER1, PER2, PER3) and Cryptochrome (CRY1, CRY2) genes and activates transcription of these genes. PER and CRY proteins heterodimerize and repress their own transcription by interacting in a feedback loop with CLOCK/ARNTL complexes. Defects in this gene have been linked to infertility, problems with gluconeogenesis and lipogenesis, and altered sleep patterns. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]'
• Locus ID: 406