SPTLC1 (NM_178324) Human 3' UTR Clone

CAT#: SC207104

3`UTR clone of serine palmitoyltransferase long chain base subunit 1 (SPTLC1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SPTLC1
• Synonyms: HSAN1; HSN1; LBC1; LCB1; SPT1; SPTI
• ACCN: NM_178324
• Insert Size: 508
• Sequence Data:
  Insert Sequence

  >SC207104 3'UTR clone of NM_178324
  The sequence shown below is from the reference sequence of NM_178324. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACTTGTGGACCCAGAGGATTTTATGGCACATTTGAATGAAGATGAAGGATCATTGATTTCCTTGTGTATG
  GATAATCCGGGAACAGGCCAACTAAATATTTGATGAATGTATGATTTCAAATACAGTGAATTCCCTGGGA
  GTCATCAAAGAAGACCGGCATTTTATGGTTGTTTTTATTAAGTGTATATTCTTTGCTCCTGAAAATGTTA
  TTAAATAATTGTTTAGGCCGGGCATGGTGGCTCATGCCTGTAATCCCAGCACTTTCAAAGGCTGAGGCAG
  GCAGATCACCTGAGGTCAGGAGTTCAAAACCAGCCTGGCCAACATGCTGAAACCTCGTCTCTACTAAAAA
  TACAAAAATTAGCTGGGCGTGGTGGTGGATACCTGTAATCCCAGCTACGTGGGAGGCTGAGGTGGGAGAA
  TTGCTTCAACCTGGGAGGCAGAGGTTGCAGTGAGCCGAGATCATGCCACTGCACTCCAGCCTGGGCAACA
  GAGCAAGACTGTCTCAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_178324.1
• Summary: This gene encodes a member of the class-II pyridoxal-phosphate-dependent aminotransferase family. The encoded protein is the long chain base subunit 1 of serine palmitoyltransferase. Serine palmitoyltransferase converts L-serine and palmitoyl-CoA to 3-oxosphinganine with pyridoxal 5'-phosphate and is the key enzyme in sphingolipid biosynthesis. Mutations in this gene were identified in patients with hereditary sensory neuropathy type 1. Alternatively spliced variants encoding different isoforms have been identified. Pseudogenes of this gene have been defined on chromosomes 1, 6, 10, and 13. [provided by RefSeq, Jul 2013]
• Locus ID: 10558