WISP2 (NM_003881) Human 3' UTR Clone

CAT#: SC207149

3`UTR clone of WNT1 inducible signaling pathway protein 2 (WISP2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: WISP2
• Synonyms: CCN5; CT58; CTGF-L
• ACCN: NM_003881
• Insert Size: 526
• Sequence Data:
  Insert Sequence

  >SC207149 3'UTR clone of NM_003881
  The sequence shown below is from the reference sequence of NM_003881. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGTCCACAAAACAGTGCCTTCTAGAGCCGGGCTGGGAATGGGGACACGGTGTCCACCATCCCCAGCTGG
  TGGCCCTGTGCCTGGGCCCTGGGCTGATGGAAGATGGTCCGTGCCCAGGCCCTTGGCTGCAGGCAACACT
  TTAGCTTGGGTCCACCATGCAGAACACCAATATTAACACGCTGCCTGGTCTGTCTGGATCCCGAGGTATG
  GCAGAGGTGCAAGACCTAGTCCCCTTTCCTCTAACTCACTGCCTAGGAGGCTGGCCAAGGTGTCCAGGGT
  CCTCTAGCCCACTCCCTGCCTACACACACAGCCTATATCAAACATGCACACGGGCGAGCTTTCTCTCCGA
  CTTCCCCTGGGCAAGAGATGGGACAAGCAGTCCCTTAATATTGAGGCTGCAGCAGGTGCTGGGCTGGACT
  GGCCATTTTTCTGGGGGTAGGATGAAGAGAAGGCACACAGAGATTCTGGATCTCCTGCTGCCTTTTCTGG
  AGTTTGTAAAATTGTTCCTGAATACAAGCCTATGCG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003881.2
• Summary: This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like (CT) domain. The encoded protein lacks the CT domain which is implicated in dimerization and heparin binding. It is 72% identical to the mouse protein at the amino acid level. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Its expression in colon tumors is reduced while the other two WISP members are overexpressed in colon tumors. It is expressed at high levels in bone tissue, and may play an important role in modulating bone turnover. [provided by RefSeq, Jul 2008]
• Locus ID: 8839