TOMM40 (NM_001128916) Human 3' UTR Clone

CAT#: SC207200

3`UTR clone of translocase of outer mitochondrial membrane 40 homolog (yeast) (TOMM40) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TOMM40"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TOMM40
Synonyms C19orf1; D19S1177E; PER-EC1; PEREC1; TOM40
ACCN NM_001128916
Insert Size 545
Sequence Data
>SC207200 3'UTR clone of NM_001128916
The sequence shown below is from the reference sequence of NM_001128916. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTTTCAGTGTGGCTTTGGCCTCACCATCGGCTGAGCCCTCCTGGCCCCCGCCTTCCACGCCCTTCCGATT
CCACCTCCACCTCCACCTCCCCCTGCCACAGAGGGGAGACCTGAGCCCCCCTCCCTTCCCTCCCCCCTTG
GGGGTCGGGGGGGACATTGGAAAGGAGGGACCCCGCCACCCCAGCAGCTGAGGAGGGGATTCTGGAACTG
AATGGCGCTTCGGGATTCTGAGTAGCAGGGGCAGCATGCCCAGTGGGCCTGGGGTCCCGGGAGGGATTCC
GGAATTGAGGGGCACGCAGGATTCTGAGCACCAGGGGCAGAGGCGGCCAGACAACCTCAGGGAGGAGTGT
CCTGGCGTCCCCATCCTCCAAAGGGCCTGGGCCCGCCCCGAGGGGGCAGCGAGAGGAGCTTCCCCATCCC
CGGTCAGTCCACCCTGCCCCGTCCACTTTCCCATCTCCTCGGTATAAATCATGTTTATAAGTTATGGAAG
AACCGGGACATTTTACAGAAAAAAAACAAAAAACAACAAAAAATATACGTGGGAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001128916.1
Summary The protein encoded by this gene is localized in the outer membrane of the mitochondria. It is the channel-forming subunit of the translocase of the mitochondrial outer membrane (TOM) complex that is essential for import of protein precursors into mitochondria. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2015]
Locus ID 10452

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.