ATP6V1E1 (NM_001039367) Human 3' UTR Clone

CAT#: SC207220

3`UTR clone of ATPase H+ transporting lysosomal 31kDa V1 subunit E1 (ATP6V1E1) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ATP6V1E1
• Synonyms: ARCL2C; ATP6E; ATP6E2; ATP6V1E; P31; Vma4
• ACCN: NM_001039367
• Insert Size: 565 bp
• Sequence Data:
  Insert Sequence

  >SC207220 3'UTR clone of NM_001039367
  The sequence shown below is from the reference sequence of NM_001039367. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGTGCAAATGCCAACAGGAAGTTTTTGGACTAAGCCTTCAGGAGGTGGAGCTCGTCGTCAGCTCTCCTGC
  TGTGATGTGGAAGCTTCTGATATTTGAAGAAACACGAATGTCTCTGTAGCTTCCTCTTCACTGCCCCAGT
  ATTGCTCTGTATTTATCAGCGATGCCCCTCTGTCACTCATGCCTTGCCTAATTGTTCACAATGGTGGAAA
  GCTTCATGTAATATGATCAGGACCCACCTCCAGTTCTTCTGAAAGTGTGACAGTGTCCAGCCGGTTCTGC
  AGCACTAGGGGAGGGGGCAGATGGTGGTTGCATGGGCTTCCTGGGTCTCCACTCTCCGTCTGGCCTAAAG
  GTGATGTATTTGGTGTTTGGCCCTGCAGTCCCCACTCTTGAGGCTTAAGGCGCATGTGGCACACCACTCC
  TTCCAGCAGTAGTCGCTTTACTGTTACCTGTTTAGGCCTAGAAGTTTTCCCTCATCTGTAAATGTGATTT
  AAAATCTAAGCCATGAATATGCTTTATTTATTAAAAGAGTTATGCGGATTTAATGTGATTTCTAGTGTAA
  GGCAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001039367.1
• Summary: 'This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain E subunit isoforms. Pseudogenes for this gene have been found in the genome. [provided by RefSeq, Jul 2008]'
• Locus ID: 529