Cyclin E1 (CCNE1) (NM_057182) Human 3' UTR Clone

CAT#: SC207261

3`UTR clone of cyclin E1 (CCNE1) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CCNE1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CCNE1
Synonyms CCNE
ACCN NM_057182
Insert Size 575 bp
Sequence Data
>SC207261 3'UTR clone of NM_057182
The sequence shown below is from the reference sequence of NM_057182. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGAGCGGTAAGAAGCAGAGCAGCGGGCCGGAAATGGCGTGACCACCCCATCCTTCTCCACCAAAGACAGT
TGCGCGCCTGCTCCACGTTCTCTTCTGTCTGTTGCAGCGGAGGCGTGCGTTTGCTTTTACAGATATCTGA
ATGGAAGAGTGTTTCTTCCACAACAGAAGTATTTCTGTGGATGGCATCAAACAGGGCAAAGTGTTTTTTA
TTGAATGCTTATAGGTTTTTTTTAAATAAGTGGGTCAAGTACACCAGCCACCTCCAGACACCAGTGCGTG
CTCCCGATGCTGCTATGGAAGGTGCTACTTGACCTAAGGGACTCCCACAACAACAAAAGCTTGAAGCTGT
GGAGGGCCACGGTGGCGTGGCTCTCCTCGCAGGTGTTCTGGGCTCCGTTGTACCAAGTGGAGCAGGTGGT
TGCGGGCAAGCGTTGTGCAGAGCCCATAGCCAGCTGGGCAGGGGGCTGCCCTCTCCACATTATCAGTTGA
CAGTGTACAATGCCTTTGATGAACTGTTTTGTAAGTGCTGCTATATCTATCCATTTTTTAATAAAGATAA
TACTGTTTTTGAGAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_057182.1
Summary 'The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2, whose activity is required for cell cycle G1/S transition. This protein accumulates at the G1-S phase boundary and is degraded as cells progress through S phase. Overexpression of this gene has been observed in many tumors, which results in chromosome instability, and thus may contribute to tumorigenesis. This protein was found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. [provided by RefSeq, Apr 2016]'
Locus ID 898

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.