FANCL (NM_001114636) Human 3' UTR Clone

CAT#: SC207279

3`UTR clone of Fanconi anemia complementation group L (FANCL) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FANCL
• Synonyms: FAAP43; PHF9; POG
• ACCN: NM_001114636
• Insert Size: 518
• Sequence Data:
  Insert Sequence

  >SC207279 3'UTR clone of NM_001114636
  The sequence shown below is from the reference sequence of NM_001114636. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGTCTGGAAGGAAACACTGAAATAAGAATACAACATTTCGGTGAAGAGCTGGAAACTTAAAAAATTATC
  AAAAGGAATTTTGGTATCATCTTCAGAGAAAAAATAAAGCAAGAAATACTAACATCAAAAGGACAGGTAT
  GATGATGCGATAATAATAAACATCTGCGTTTGTCTCTTCACTAAGAGTAAACTGGGAAATTGTAGGCCAA
  AGTCCAGTTGAACTTTCTAAGTCTGTGATCCCCGTGCTGACTGTGGAAGTGTATTTATACCAAGATGGAG
  ATCTTGACTTCTTGAATATATCTGGACTGGTAAAATCTTGATGAGGCTCATAAAATGAGTTTGGGAATTG
  TGTATAGCTGATTTTTTGTGGGAAACTGTTTACTTCATTCAAAGGTTCTTGAGACTCTTGATATTTCTGT
  CTTCTCCTTGTGCTTTCCTATGGAAAAAATACATATATAGTTTAGTTTGTTAGACGTGAGTTATCCAAGT
  ATTTATTTTGTGTAGTGTGTAAGAATGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001114636.1
• Summary: This gene encodes a ubiquitin ligase that is a member of the Fanconi anemia complementation group (FANC). Members of this group are related by their assembly into a common nuclear protein complex rather than by sequence similarity. This gene encodes the protein for complementation group L that mediates monoubiquitination of FANCD2 as well as FANCI. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2018]
• Locus ID: 55120