CLTCL1 (NM_001835) Human 3' UTR Clone

CAT#: SC207289

3`UTR clone of clathrin heavy chain-like 1 (CLTCL1) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CLTCL1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CLTCL1
Synonyms CHC22; CLH22; CLTCL; CLTD
ACCN NM_001835
Insert Size 517
Sequence Data
>SC207289 3'UTR clone of NM_001835
The sequence shown below is from the reference sequence of NM_001835. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCTCGTGTTTGATTTTGATGGGCATGAATGAGACCCAGCTGATTGCACTAAGCCCTGCCGTGGGCCCAGC
CCCTGCCAGCTTCCCCTATGGATATGCCTCTGCTCCCAACTTCGCCAGCCTCCAATGTACAACTTCCGCG
TGTAGTGGGCGTTGTCACCACCCACCCTACCTGCAGAGTTACTAACTTCTCCAAGGAGCATGTCACTCCA
GCAGCACAGGGGACGCAATGGGAGGCAGGGACACCTGGACAATATTTATTTTTGCTGAAACCCAATGACG
GCAACCTCTGAGCCATCCCAGAGCCTGGGGAGGCCAGGGTAGAGGCTGACGGCGCAAGACCAGCTTTAGC
CGACAACAGAGACTGGACTGTGGGCCCTCCTGCTGGAGCCAGGCCTTCCTCCTGGGCGCCTCCGACTGGC
TGGAGCTGCCCCCTCCAGGCCAGTTTGAAGACTACATGAACACGTCTTGTTTGGAGGTACCGGACCTCAT
AAAAGGACTCTCAGCCTCTTGGCAATC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001835.3
Summary This gene is a member of the clathrin heavy chain family and encodes a major protein of the polyhedral coat of coated pits and vesicles. Chromosomal aberrations involving this gene are associated with meningioma, DiGeorge syndrome, and velo-cardio-facial syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
Locus ID 8218

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.