Calpain 3 (CAPN3) (NM_000070) Human 3' UTR Clone

CAT#: SC207295

3`UTR clone of calpain 3 (p94) (CAPN3) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CAPN3
• Synonyms: CANP3; CANPL3; LGMD2; LGMD2A; LGMDD4; LGMDR1; nCL-1; p94
• ACCN: NM_000070
• Insert Size: 563 bp
• Sequence Data:
  Insert Sequence

  >SC207295 3'UTR clone of NM_000070
  The sequence shown below is from the reference sequence of NM_000070. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCTCACCATGTATGCCTGAACCAGGCTGGCCTCATCCAAAGCCATGCAGGATCACTCAGGATTTCAGTT
  TCACCCTCTATTTCCAAAGCCATTTACCTCAAAGGACCCAGCAGCTACACCCCTACAGGCTTCCAGGCAC
  CTCATCAGTCATGCTCCTCCTCCATTTTACCCCCTACCCATCCTTGATCGGTCATGCCTAGCCTGACCCT
  TTAGTAAAGCAATGAGGTAGGAAGAACAAACCCTTGTCCCTTTGCCATGTGGAGGAAAGTGCCTGCCTCT
  GGTCCGAGCCGCCTCGGTTCTGAAGCGAGTGCTCCTGCTTACCTTGCTCTAGGCTGTCTGCAGAAGCACC
  TGCCGGTGGCACTCAGCACCTCCTTGTGCTAGAGCCCTCCATCACCTTCACGCTGTCCCACCATGGGCCA
  GGAACCAAACCAGCACTGGGTTCTACTGCTGTGGGGTAAACTAACTCAGTGGAATAGGGCTGGTTACTTT
  GGGCTGTCCAACTCATAAGTTTGGCTGCATTTTGAAAAAAGCTGATCTAAATAAAGGCATGTGTATGGCT
  GGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000070.2
• Summary: 'Calpain, a heterodimer consisting of a large and a small subunit, is a major intracellular protease, although its function has not been well established. This gene encodes a muscle-specific member of the calpain large subunit family that specifically binds to titin. Mutations in this gene are associated with limb-girdle muscular dystrophies type 2A. Alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms and some variants are ubiquitously expressed. [provided by RefSeq, Jul 2008]'
• Locus ID: 825