SFRS5 (SRSF5) (NM_006925) Human 3' UTR Clone

CAT#: SC207300

3`UTR clone of splicing factor arginine/serine-rich 5 (SFRS5) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SRSF5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SRSF5
Synonyms HRS; SFRS5; SRP40
ACCN NM_006925
Insert Size 546 bp
Sequence Data
>SC207300 3'UTR clone of NM_006925
The sequence shown below is from the reference sequence of NM_006925. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGGTCCAGATCAGTTGACAGTGGCAATTAAACTGTAAATAACTTGCCCTGGGGGCCTTTTTTTAAAAAAC
AAAAACCACAAAAATTCCCAAACCATACTTGCTAAAAATTCTGGTAAGTATGTGCTTTTCTGTGGGGGTG
GGATTTGGAAGGGGGGTTGGGTTGGGCTGGATATCTTTGTAGATGTGGACCACCAAGGGGTTGTTGAAAA
CTAATTGTATTAAATGTCTTTTGATAAGCCTTCTGCTCACATTTTTGTGAATGTCTGAAGTATATAGTTT
GTGTATATTGACAGAGCTCTTTTATAACTAAAGCAAATTTAATTTTTTTGTACTAGAAAAAAATTTGAAC
ATTTTAGTTCTTGGTTATAAAAATGTTAATTCAGAATTAGTTTAATGCCTTAATTAAACTAATTAATAGC
TTTGGACACTTAAAAGAGCTCTAAATTTGCTTGTACATAAAGGCTTAATTTGTTTTCCTTGTTAGGGTCA
AGGGTGTCCTCCACTCTTTAACAGCTGCTGGACAGACACATTAGAGCAGCTGTTTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006925.3
Summary 'The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]'
Locus ID 6430

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.