KCNMB4 (NM_014505) Human 3' UTR Clone

CAT#: SC207311

3`UTR clone of potassium large conductance calcium-activated channel subfamily M beta member 4 (KCNMB4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KCNMB4
• Synonyms: calcium-activated potassium channel beta 4 subunit; large conductance calcium-dependent potassium ion channel beta 4 subunit; potassium large conductance calcium-activated channel, subfamily M, beta member 4
• ACCN: NM_014505
• Insert Size: 553
• Sequence Data:
  Insert Sequence

  >SC207311 3'UTR clone of NM_014505
  The sequence shown below is from the reference sequence of NM_014505. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCCATGAAGAAGCGCAAGTTCTCTTAAAGGGGAAGGAGGCTTGTAGAAAGCAAAGTACAGAAGCTGTAC
  TCATCGGCACGCGTCCACCTGCGGAACCTGTGTTTCCTGGCGCAGGAGATGGACAGGGCCACGACAGGGC
  TCTGAGAGGCTCATCCCTCAGTGGCAACAGAAACAGGCACAACTGGAAGACTTGGAACCTCAAAGCTTGT
  ATTCCATCTGCTGTAGCAATGGCTAAAGGGTCAAGATCTTAGCTGTATGGAGTAACTATTTCAGAAAACC
  CTATAAGAAGTTCATTTTCTTTCAAAAGTAACAGTATATTATTTGTACAGTGTAGTATACAAACCATTAT
  GATTTATGCTACTTAAAAATATTAAAATAGAGTGGTCTGTGTTATTTTCTATTTCCTTTTTTATGCTTAG
  AACACCAGGGTTTAAAAAAAAAAAAAAGGTGAGGACATCTGGGTCTCATTTGCTTCTGCTAGGTTAAACT
  TTTACTTGACAACAAGGATTCCTGCTGAAGTCTGAACCTTACTGTGTAACCCTCAGTTTCCAC
  
  CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-RsrII
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014505.4
• Summary: MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which slows activation kinetics, leads to steeper calcium sensitivity, and shifts the voltage range of current activation to more negative potentials than does the beta 1 subunit. [provided by RefSeq, Jul 2008]
• Locus ID: 27345