AUH (NM_001698) Human 3' UTR Clone

CAT#: SC207329

3`UTR clone of AU RNA binding protein/enoyl-Coenzyme A hydratase (AUH) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AUH
• Synonyms: 3-methylglutaconyl-CoA hydratase; AU-binding protein; AU-specific RNA-binding enoyl-CoA hydratase; AU RNA-binding protein; AU RNA binding protein; Enoyl-CoA hydratase; enoyl-Coenzyme A hydratase; OTTHUMP00000021631
• ACCN: NM_001698
• Insert Size: 528 bp
• Sequence Data:
  Insert Sequence

  >SC207329 3'UTR clone of NM_001698
  The sequence shown below is from the reference sequence of NM_001698. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCCTCGCTATAAAGGAGAATAAAAGGAACAGAAATTCTTAAGATGCCAATGTAATAAATGTACTTCCTGG
  AAGTGTCTTTCGGATCCACTATATGCCTCAGCACATGGAACCTTAATGACCAAAGTGAAGAGCAGATTAT
  TCATACGGTGTAATAAGCATCTGGAATGGACCCATCCGTGTACTTCATTCAAATGTGTAAATGTCATATT
  CATTCAGATTTATAAAGCTAGTAGTGTATAGTCAGAAACAGAATCAAAGTTAGATATACATTTTTAAATA
  TTTACTGCATATGAGGCTTTCTGTTAATTTTTTAATGTGAATAATTTATATATTGCACATTCTAGGGAAT
  AATATTGATTGTATGTCTACTGTGCTGCATTAAGAAAATAAAATTTCTATATACCAAAAATGTGAAGTTA
  TACCAAATAAAGTTTCTAAGTGATTAATGCATACGAACAGCTACATATACATATATCTAAACCTGAAAAA
  TGAATTGATATTCTGAGTGAAAACTACCTAATATAAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001698.2
• Summary: 'This gene encodes bifunctional mitochondrial protein that has both RNA-binding and hydratase activities. The encoded protein is a methylglutaconyl-CoA hydratase that catalyzes the hydration of 3-methylglutaconyl-CoA to 3-hydroxy-3-methyl-glutaryl-CoA, a critical step in the leucine degradation pathway. This protein also binds AU-rich elements (AREs) found in the 3' UTRs of rapidly decaying mRNAs including c-fos, c-myc and granulocyte/ macrophage colony stimulating factor. ARE elements are involved in directing RNA to rapid degradation and deadenylation. This protein is localizes to the mitochondrial matrix and the inner mitochondrial membrane and may be involved in mitochondrial protein synthesis. Mutations in this gene are the cause of 3-methylglutaconic aciduria, type I. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]'
• Locus ID: 549