ATP6V0E1 (NM_003945) Human 3' UTR Clone

CAT#: SC207341

3`UTR clone of ATPase H+ transporting lysosomal 9kDa V0 subunit e1 (ATP6V0E1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ATP6V0E1
• Synonyms: ATP6H; ATP6V0E; M9.2; Vma21; Vma21p
• ACCN: NM_003945
• Insert Size: 571
• Sequence Data:
  Insert Sequence

  >SC207341 3'UTR clone of NM_003945
  The sequence shown below is from the reference sequence of NM_003945. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAACCATCTGGTATCTGAAGTATCATTGGCCTTGAGGAAGAAGACATGCTCTACAGTGCTCAGTCTTTG
  AGGTCACGAGAAGAGAATGCCTTCTAGATGCAAAATCACCTCCAAACCAGACCACTTTTCTTGACTTGCC
  TGTTTTGGCCATTAGCTGCCTTAAACGTTAACAGCACATTTGAATGCCTTATTCTACAATGCAGCGTGTT
  TTCCTTTGCCTTTTTTGCACTTTGGTGAATTACGTGCCTCCATAACCTGAACTGTGCCGACTCCACAAAA
  CGATTATGTACTCTTCTGAGATAGAAGATGCTGTTCTTCTGAGAGATACGTTACTCTCTCCTTGGAATCT
  GTGGATTTGAAGATGGCTCCTGCCTTCTCACGTGGGAATCAGTGAAGTGTTTAGAAACTGCTGCAAGACA
  AACAAGACTCCAGTGGGGTGGTCAGTAGGAGAGCACGTTCAGAGGGAAGAGCCATCTCAACAGAATCGCA
  CCAAACTATACTTTCAGGATGAATTTCTTCTTTCTGCCATCTTTTGGAATAAATATTTTCCTCCTTTCTA
  TGGAAATCTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003945.3
• Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is possibly part of the V0 subunit. Since two nontranscribed pseudogenes have been found in dog, it is possible that the localization to chromosome 2 for this gene by radiation hybrid mapping is representing a pseudogene. Genomic mapping puts the chromosomal location on 5q35.3. [provided by RefSeq, Jul 2008]
• Locus ID: 8992