GBA (NM_001005741) Human 3' UTR Clone

CAT#: SC207345

3`UTR clone of glucosidase beta; acid (includes glucosylceramidase) (GBA) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GBA
Synonyms GBA1; GCB; GLUC
ACCN NM_001005741
Insert Size 552 bp
Sequence Data
>SC207345 3'UTR clone of NM_001005741
The sequence shown below is from the reference sequence of NM_001005741. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTCCATTCACACCTACCTGTGGCGTCGCCAGTGATGGAGCAGATACTCAAGGAGGCACTGGGCTCAGCCT
GGGCATTAAAGGGACAGAGTCAGCTCACACGCTGTCTGTGACTAAAGAGGGCACAGCAGGGCCAGTGTGA
GCTTACAGCGACGTAAGCCCAGGGGCAATGGTTTGGGTGACTCACTTTCCCCTCTAGGTGGTGCCAGGGG
CTGGAGGCCCCTAGAAAAAGATCAGTAAGCCCCAGTGTCCCCCCAGCCCCCATGCTTATGTGAACATGCG
CTGTGTGCTGCTTGCTTTGGAAACTGGGCCTGGGTCCAGGCCTAGGGTGAGCTCACTGTCCGTACAAACA
CAAGATCAGGGCTGAGGGTAAGGAAAAGAAGAGACTAGGAAAGCTGGGCCCAAAACTGGAGACTGTTTGT
CTTTCCTGGAGATGCAGAACTGGGCCCGTGGAGCAGCAGTGTCAGCATCAGGGCGGAAGCCTTAAAGCAG
CAGCGGGTGTGCCCAGGCACCCAGATGATTCCTATGGCACCAGCCAGGAAAAATGGCAGCTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001005741.2
Summary 'This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]'
Locus ID 2629

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.