GBA (NM_001005742) Human 3' UTR Clone

CAT#: SC207346

3`UTR clone of glucosidase beta; acid (includes glucosylceramidase) (GBA) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GBA
• Synonyms: GBA1; GCB; GLUC
• ACCN: NM_001005742
• Insert Size: 552 bp
• Sequence Data:
  Insert Sequence

  >SC207346 3'UTR clone of NM_001005742
  The sequence shown below is from the reference sequence of NM_001005742. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCCATTCACACCTACCTGTGGCGTCGCCAGTGATGGAGCAGATACTCAAGGAGGCACTGGGCTCAGCCT
  GGGCATTAAAGGGACAGAGTCAGCTCACACGCTGTCTGTGACTAAAGAGGGCACAGCAGGGCCAGTGTGA
  GCTTACAGCGACGTAAGCCCAGGGGCAATGGTTTGGGTGACTCACTTTCCCCTCTAGGTGGTGCCAGGGG
  CTGGAGGCCCCTAGAAAAAGATCAGTAAGCCCCAGTGTCCCCCCAGCCCCCATGCTTATGTGAACATGCG
  CTGTGTGCTGCTTGCTTTGGAAACTGGGCCTGGGTCCAGGCCTAGGGTGAGCTCACTGTCCGTACAAACA
  CAAGATCAGGGCTGAGGGTAAGGAAAAGAAGAGACTAGGAAAGCTGGGCCCAAAACTGGAGACTGTTTGT
  CTTTCCTGGAGATGCAGAACTGGGCCCGTGGAGCAGCAGTGTCAGCATCAGGGCGGAAGCCTTAAAGCAG
  CAGCGGGTGTGCCCAGGCACCCAGATGATTCCTATGGCACCAGCCAGGAAAAATGGCAGCTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001005742.2
• Summary: 'This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]'
• Locus ID: 2629