RGR (NM_001012722) Human 3' UTR Clone

CAT#: SC207358

3`UTR clone of retinal G protein coupled receptor (RGR) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol RGR
Synonyms RP44
ACCN NM_001012722
Insert Size 567 bp
Sequence Data
>SC207358 3'UTR clone of NM_001012722
The sequence shown below is from the reference sequence of NM_001012722. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAGGACCGAACCAAGTGAGCCTGCCACCCTGGAGTGAGCCCCAGGCCAGGAGGCTGTTCCAGGAGTCCTG
CCCAGCAGCCTCAGTGGCCAAGCCCAGACACTCACCCACCTTCCCCAGTGGCCCCGTGGATCCTGGTCCT
AGGCTGGACACAGGATTCAGAAAGACACCAGGCTGCACAGAAAGAGCCAGATGGACCTGAGTGTCGGTCA
CAGCCCCCTACACTCAAGGCTGAGAGGCCTCAGGAAAGTCATTCCTTTTTAAAAATAATAATAAATGTAA
GGGGGTACAGTGCAGTTTTGTTACATGGATAGATTGCCTAGTGGTGAAGTCTGGGCTTTTAGTGTAACCA
TCACCCTAATAATATACGTTGTACCCATTAAGTTATTTCTCATCCCTCACCCCCTCCCACCTTGTCACCC
TTCTGAGTCTCCAATGTCTATTATTCCACACTCCATGTCCACGTGTACACATTATTTAGCTCCCACTTAC
AAGTGAGAACATGTGGTATTTGACTTTCTGTTTTTGAGTTATTTCACTTAAAATAATGACCTCCAGTTTC
ATCCATG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001012722.1
Summary 'This gene encodes a putative retinal G-protein coupled receptor. The gene is a member of the opsin subfamily of the 7 transmembrane, G-protein coupled receptor 1 family. Like other opsins which bind retinaldehyde, it contains a conserved lysine residue in the seventh transmembrane domain. The protein acts as a photoisomerase to catalyze the conversion of all-trans-retinal to 11-cis-retinal. The reverse isomerization occurs with rhodopsin in retinal photoreceptor cells. The protein is exclusively expressed in tissue adjacent to retinal photoreceptor cells, the retinal pigment epithelium and Mueller cells. This gene may be associated with autosomal recessive and autosomal dominant retinitis pigmentosa (arRP and adRP, respectively). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]'
Locus ID 5995

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.