CYP3A43 (NM_022820) Human 3' UTR Clone

CAT#: SC207362

3`UTR clone of cytochrome P450 family 3 subfamily A polypeptide 43 (CYP3A43) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CYP3A43
• Synonyms: MGC119315; MGC119316
• ACCN: NM_022820
• Insert Size: 543
• Sequence Data:
  Insert Sequence

  >SC207362 3'UTR clone of NM_022820
  The sequence shown below is from the reference sequence of NM_022820. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGATTACAAGTGGACCCTGACTTTCCCTAAGGACTTCCACTTTGTTCAAGAAAGCTGTATCCCAGAACAC
  TAGACACTTCAAATTGTTTTGTGAATAAAACTCAGAAATGAAGATGAGCTTAATTAACCTAGTATACTGG
  GTGAATAATTAGAAATTCTCTACATTCATTGAGCTCTCATTGTCTGGGTAGAGTATTACACGTTGCATAC
  TACAAAGCAGGTGACAAATCAATGCCAAATAAGTACAGTCATCTTCTCTAGTTCTCATAAGACTATCTCC
  CCGCCACCTATAGTTAGTACCCTCAAGTCCTCCTGAGCTGTGATCAGAGAATAAACATTTCTCAACAATT
  TTACCAACAATTTTTAATGAAAAGGAAAATTATACTTGTGATTCTCGTAGTGACATTTATATTACATGTT
  CCATTTGTGATATTCTATAATAAGTATTATATTGAGAAAGTCAACAAGCACCTCTTTACAAAACTGTTAT
  CTGATGTCTTCCTGCATATTAAGGATGAATCTACAGAATTAGATCAATAAGGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_022820.3
• Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein has a low level of testosterone hydroxylase activity, and may play a role in aging mechanisms and cancer progression. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
• Locus ID: 64816