VPS25 (NM_032353) Human 3' UTR Clone

CAT#: SC207378

3`UTR clone of vacuolar protein sorting 25 homolog (S. cerevisiae) (VPS25) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "VPS25"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol VPS25
Synonyms DERP9; EAP20; FAP20
ACCN NM_032353
Insert Size 557
Sequence Data
>SC207378 3'UTR clone of NM_032353
The sequence shown below is from the reference sequence of NM_032353. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCGAGATCATCACTGTCAGCGATGGCCGAGGCGTCAAGTTCTTCTAGCAGGGACCTGTCTCCCTTTACTT
CTTACCTCCCACCTTTCCAGGGCTTTCAAAAGGAGACAGACCCAGTGTCCCCCAAAGACTGGATCTGTGA
CTCCACCAGACTCAAAAGGACTCCAGTCCTGAAGGCTGGGACCTGGGGATGGGTTTCTCACACCCCATAT
GTCTGTCCCTTGGATAGGGTGAGGCTGAAGCACCAGGGAGAAAATATGTGCTTCTTCTCGCCCTACCTCC
TTTCCCATCCTAGACTGTCCTTGAGCCAGGGTCTGTAAACCTGACACTTTATATGTGTTCACACATGTAA
GTACATACACACATGCGCCTGCAGCACATGCTTCTGTCTCCTCCTCCTCCCACCCCTTTAGCTGCTGTTG
CCTCCCTTCTCAGGCTGGTGCTGGATCCTTCCTAGGGGATGGGGGAAGCCCTGGCTGCAGGCAGCCTTCC
AGGCAATATGAAGATAGGAGGCCCACGGGCCTGGCAGTGAGAGGTGTGGCCCCACACCGATTTATGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032353.2
Summary This gene encodes a protein that is a subunit of the endosomal sorting complex required for transport II (ESCRT-II). This protein complex functions in sorting of ubiquitinated membrane proteins during endocytosis. A pseudogene of this gene is present on chromosome 1. [provided by RefSeq, Jul 2013]
Locus ID 84313

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.