UBE2E3 (NM_006357) Human 3' UTR Clone

CAT#: SC207387

3`UTR clone of ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog yeast) (UBE2E3) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UBE2E3
• Synonyms: UBCH9; UbcM2
• ACCN: NM_006357
• Insert Size: 556
• Sequence Data:
  Insert Sequence

  >SC207387 3'UTR clone of NM_006357
  The sequence shown below is from the reference sequence of NM_006357. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AACACGACAGGATAGCCAGACAGTGGACCAAGAGATACGCAACATAATTCACATAATTTGTATGCAGTGT
  GAAGGAGCAGAAGGCATCTTCTCACTGTGCTGCAAATCTTTATAGCCTTTACAATACGGACTTCTGTGTA
  TATGTTATACTGATTCTACTCTGCTTTTATCCTTTGGAGCCTGGGAGACTCCCCAAAAAGGTAAATGCTA
  TCAAGAGTAGAACTTTGTAGCTGTAGATTAGTTATGTTTAAAACGCCTACTTGCAAGTCTTGCTTCTTTG
  GGATATCAAAATGTATTTTGTGATGTACTAAGGATACTGGTCCTGAAGTCTACCAAATATTATAGTGCAT
  TTTAGCCTAATTCATTATCTGTATGAAGTTATAAAAGTAGCTGTAGATGGCTAGGAATTATGTCATTTGT
  ATTAAACCCAGATCTATTTCTGAGTATGTGGTTCATGCTGTTGTGAAAAATGTTTTACCTTTTACCTTTG
  TCAGTTTGTAATGAGAGGATTTCCTTTTACCCTTTGTAGCTCAGAGAGCACCTGATGTATCATCTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006357.2
• Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse and rat counterparts, which indicates that this enzyme is highly conserved in eukaryotes. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2013]
• Locus ID: 10477