GTF2H3 (NM_001516) Human 3' UTR Clone

CAT#: SC207405

3`UTR clone of general transcription factor IIH polypeptide 3 34kDa (GTF2H3) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GTF2H3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GTF2H3
Synonyms BTF2; P34; TFB4; TFIIH
ACCN NM_001516
Insert Size 599 bp
Sequence Data
>SC207405 3'UTR clone of NM_001516
The sequence shown below is from the reference sequence of NM_001516. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTCCAGTGCTGAAAGCCAAGAAAAAGAAACTGAAAGTGTCTGCCTGAGGATAAAATATTTTCCCCATCTT
TTAGAGCTGTTAATAGAAATTATATAGCAGATTCTTTGTTGGGAAGACTGAAAAAAATAAAGATAGGTAT
AGGATAATTTTTAATATGGTGACCTTACAGAAAATATTTCCCAAACATCCTTTTCATCCTGTGCTTCTGG
AGGACTGATTTGTTTGAGGGAATCATTCTATGCATTATATCCTAAAATATTCTATGACTGGTTTCTGTCC
ATGTTTGTGGCTTTCATTTTTTTAATGGGATGACTATTAGTCAAAGTCAGCTTGTCATGACTCATCATAG
GCTTTCTAACCTACTCCCTGAATCCGGGTCCTCATTGTGAAATGCATGCCATACGAAATTTGAACGTAGC
TTTGGAAAAAGGGACTATTTGTGGAGTAATGGCATTAATCAACATAGAACATCTTATTTGAATCAACAGT
TAACTTCAGTAGTCATGTGAATAAAATTCTTATTGTCTAAATTGAGACAGCCTCAGATATTTGCAGATAT
TTACTTTTTGTCTGATATCAGTACATATTTGGACAAAGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001516.3
Summary 'This gene encodes a member of the TFB4 family. The encoded protein is a subunit of the core-TFIIH basal transcription factor and localizes to the nucleus. The encoded protein is involved in RNA transcription by RNA polymerase II and nucleotide excision repair and associates with the Cdk-activating kinase complex. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 14. [provided by RefSeq, Dec 2012]'
Locus ID 2967

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.