GTF2H2 (NM_001515) Human 3' UTR Clone

CAT#: SC207413

3`UTR clone of general transcription factor IIH polypeptide 2 44kDa (GTF2H2) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GTF2H2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GTF2H2
Synonyms BTF2; BTF2P44; p44; T-BTF2P44; TFIIH
ACCN NM_001515
Insert Size 558 bp
Sequence Data
>SC207413 3'UTR clone of NM_001515
The sequence shown below is from the reference sequence of NM_001515. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGATTCCAGCTCCTTCAGGTGTTTGATTCCAGCATGTAGTATACATTGTATGTGTTAAAAAGAAATTTGC
AACTGTGAATAAAAGGACTTCTTTAGAAGAAGCTTCATTTAAAACATGAAAGGATAATCTGACTTAAGAA
ACTTTTTGCTAAGAAAAGGTAATATTTTATTAAATTTTAAATTTGTGTTGTCACAGAAATACCTGAAATT
CAGTAGTACTTCATTCAATTAATTTTGTTTTCTATTATTTTGAGTTATACTGTTTTCAAAGTCATTATGC
AGTATGTATAAACTTATAAGAATTAAATTGATGTGATAATTTTATGTTTTTATAATTAAATATAGAATCT
TTATGATTTATGTTAATTCATTAATTTAGTGTAAGAAGAAAGTTAAGTCTGAATGTAAATTCAGTGTAAG
ATGAAAATTTATCAATACTTATGAAATTAGGCTGGGCGCTGTGGCTCACACCTGTAATCCCAACACTTTG
GGAGGCTGAGGTGGGCAGATCACCTGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001515.3
Summary 'This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This gene is within the telomeric copy of the duplication. Deletion of this gene sometimes accompanies deletion of the neighboring SMN1 gene in spinal muscular atrophy (SMA) patients but it is unclear if deletion of this gene contributes to the SMA phenotype. This gene encodes the 44 kDa subunit of RNA polymerase II transcription initiation factor IIH which is involved in basal transcription and nucleotide excision repair. Transcript variants for this gene have been described, but their full length nature has not been determined. A second copy of this gene within the centromeric copy of the duplication has been described in the literature. It is reported to be different by either two or four base pairs; however, no sequence data is currently available for the centromeric copy of the gene. [provided by RefSeq, Jul 2008]'
Locus ID 2966

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.