CACNG3 (NM_006539) Human 3' UTR Clone

CAT#: SC207415

3`UTR clone of calcium channel voltage-dependent gamma subunit 3 (CACNG3) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CACNG3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CACNG3
Synonyms Cacng2; calcium channel, voltage-dependent, gamma subunit 3; neuronal voltage-gated calcium channel gamma-3 subunit; voltage-dependent calcium channel gamma-3 subunit; voltage-gated calcium channel gamma subunit
ACCN NM_006539
Insert Size 568
Sequence Data
>SC207415 3'UTR clone of NM_006539
The sequence shown below is from the reference sequence of NM_006539. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCACCACGCCCGTCTGAACTGACCTCTGACCTCTGCCCCACGCCCAGCACAGCCTTGGGGGAAGTGTACA
GAGATGTCTCTGAGGTTGCATGGCATGGTCCTTGTGATGGTATTACTTTTTACAAAGAATGAAACCAAAT
GGACTCAGCCCTCTCCCACATTTTCCCCTCACCCTCCAAGTCCTAACCCCTCCATCCTCTCTAACTTTTC
AAGCCAATCCCTTAATGTCATTCCTCTCTCTGTGTATCTGTGCCAGATGTTTTCCTTTCTTCCTTCTTTA
CTGGAAGGACCTCCACATTCTTCCCTCCTTGGAAGAGGACTTTACTAAAAGTCACAGGTGGTGGCCAGGG
GGGATTTCCGAATCTCCATCAGGCGCGCTCATAGTTGTCCCCATTGTCTACCCACACAAATCCTCAGGAA
ACCAACCACCGCCCAGGTGGCCCTGAGGGAGGCATTCACCTTTATGTGTTAGAAAAACATGACCAGAAAT
CAAAGATGTCAGAGCCCCGAAGCAGCTAATGTAATAAGCACTCATGTTATTAAAGGTTTTGCCTTGTCGT
AACCAACC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006539.2
Summary The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family. This gene is a susceptibility locus for childhood absence epilepsy. [provided by RefSeq, Dec 2010]
Locus ID 10368

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.