Dishevelled 2 (DVL2) (NM_004422) Human 3' UTR Clone

CAT#: SC207417

3`UTR clone of dishevelled dsh homolog 2 (Drosophila) (DVL2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DVL2
• Synonyms: dishevelled, dsh homolog 2 (Drosophila); dishevelled 2; dishevelled 2 (homologous to Drosophila dsh); DSH homolog 2; segment polarity protein dishevelled homolog DVL-2
• ACCN: NM_004422
• Insert Size: 547 bp
• Sequence Data:
  Insert Sequence

  >SC207417 3'UTR clone of NM_004422
  The sequence shown below is from the reference sequence of NM_004422. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGCGAGTTCTTTGTGGATGTTATGTAGCCCACTGTGGGGCCAGGCTGGGCCGGGCGCTCCTGGTGTGT
  GACTGGGTGTCCTGGCCGTCATGTGCTTGCTCTTACAGTGCCTGGGCTCAGCCTACCAGCTGCTGCCATA
  CAGGAGATTGTGGCCACTGTGACTCTCACCAGCAGTGCCTGGTTCCTCCCCCTTCCCTCAGGGGTAGACA
  AGGGACCTTTGATTATTTTTAGCTTTGTTTTTTTATAAGCCTTTTTGGGGGTTAAAATAGAGTTTCTTAC
  ATTTTTGGGACTTTTTTAATAGGCATTTCCTCTTTTATATGAAGAATTCCCATCCATTGGGCCCCTTCTA
  ACCCCAGAATGTGACCTCCTCCTCCAGTTACCCACAGCCCTGCCCTTTGCAGGGTTGGGGGTGGTCAGCG
  GTACCCCGGGGTTAGGCATCCTAGACAGCAGCCTGAGGAAGCTGGGAGATTTGGGCCATGTAGCTGCCTT
  TGTTACTCTATTTATTTTAGTCACTTGTATAAAACACCAAATAAAGCAATAGAGGCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004422.2
• Summary: 'This gene encodes a member of the dishevelled (dsh) protein family. The vertebrate dsh proteins have approximately 40% amino acid sequence similarity with Drosophila dsh. This gene encodes a 90-kD protein that undergoes posttranslational phosphorylation to form a 95-kD cytoplasmic protein, which may play a role in the signal transduction pathway mediated by multiple Wnt proteins. The mechanisms of dishevelled function in Wnt signaling are likely to be conserved among metazoans. [provided by RefSeq, Jul 2008]'
• Locus ID: 1856