VEGFD (NM_004469) Human 3' UTR Clone

CAT#: SC207426

3`UTR clone of c-fos induced growth factor (vascular endothelial growth factor D) (FIGF) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: VEGFD
• Synonyms: FIGF; VEGF-D
• ACCN: NM_004469
• Insert Size: 557 bp
• Sequence Data:
  Insert Sequence

  >SC207426 3'UTR clone of NM_004469
  The sequence shown below is from the reference sequence of NM_004469. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACAGCCGAAAGAATCCTTGATTCAGCGTTCCAAGTTCCCCATCCCTGTCATTTTTAACAGCATGCTGCT
  TTGCCAAGTTGCTGTCACTGTTTTTTTCCCAGGTGTTAAAAAAAAAATCCATTTTACACAGCACCACAGT
  GAATCCAGACCAACCTTCCATTCACACCAGCTAAGGAGTCCCTGGTTCATTGATGGATGTCTTCTAGCTG
  CAGATGCCTCTGCGCACCAAGGAATGGAGAGGAGGGGACCCATGTAATCCTTTTGTTTAGTTTTGTTTTT
  GTTTTTTGGTGAATGAGAAAGGTGTGCTGGTCATGGAATGGCAGGTGTCATATGACTGATTACTCAGAGC
  AGATGAGGAAAACTGTAGTCTCTGAGTCCTTTGCTAATCGCAACTCTTGTGAATTATTCTGATTCTTTTT
  TATGCAGAATTTGATTCGTATGATCAGTACTGACTTTCTGATTACTGTCCAGCTTATAGTCTTCCAGTTT
  AATGAACTACCATCTGATGTTTCATATTTAAGTGTATTTAAAGAAAATAAACACCATTATTCAAGCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004469.2
• Summary: 'The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family and is active in angiogenesis, lymphangiogenesis, and endothelial cell growth. This secreted protein undergoes a complex proteolytic maturation, generating multiple processed forms which bind and activate VEGFR-2 and VEGFR-3 receptors. This protein is structurally and functionally similar to vascular endothelial growth factor C. Read-through transcription has been observed between this locus and the upstream PIR (GeneID 8544) locus. [provided by RefSeq, Feb 2011]'
• Locus ID: 2277