TAB1 (NM_153497) Human 3' UTR Clone

CAT#: SC207454

3`UTR clone of mitogen-activated protein kinase kinase kinase 7 interacting protein 1 (MAP3K7IP1) transcript variant beta for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TAB1
• Synonyms: 3 -Tab1; MAP3K7IP1; 3'-Tab1
• ACCN: NM_153497
• Insert Size: 596
• Sequence Data:
  Insert Sequence

  >SC207454 3'UTR clone of NM_153497
  The sequence shown below is from the reference sequence of NM_153497. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGCCAACTAAACCTCCTGGGCAGCCTGACCCCAGGGTAGGAAGGAAGCGCCTACACCAAGGGGCCCTCT
  GGGAGCTGAGATCATCCTGGGGTTTTGTCGCCTGGTCTGACTTGTGCACTGGGATCTTCTCGTGCCAGGC
  CAGGCCCCGCCCCCTCCCCGGGACTGGGCAGACCCCCTCCCTCATGCATCTGTGTCCACTGAGGCTTCCC
  TCACCTAGAATGGCCCATCCTTCAGGACCCAGCTCACTCTCATCTTCTTTCCAGGGACTTATCCCCCAAG
  GCTGTCCTCTGTTCTGGTGAGCTCAGGGCTCTTGGAACTTGGTCTGCAGTGACTCTGGGGTTCCTGGTTA
  GGACCCATGTTCTCTAGGTCCCAGCACCCTGCACGGGGCAGTGTTTGTGACACTGGGCCCAGCTATTCTG
  AGAGAAGGACTCCAACCTTCCATCAGGTGTGGCCCGAGATGTGGGTGGCCCTGGGCATGGGGCATGGATG
  CATTGTGACTTTCATGGGCCTCTTCTGCAAAAAAAAAATTAAAATTATACTTTATGACTATTGGTAGAAA
  GATAAATATATTAATACATTAAAATTTCTCTTTGAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_153497.2
• Summary: The protein encoded by this gene was identified as a regulator of the MAP kinase kinase kinase MAP3K7/TAK1, which is known to mediate various intracellular signaling pathways, such as those induced by TGF beta, interleukin 1, and WNT-1. This protein interacts and thus activates TAK1 kinase. It has been shown that the C-terminal portion of this protein is sufficient for binding and activation of TAK1, while a portion of the N-terminus acts as a dominant-negative inhibitor of TGF beta, suggesting that this protein may function as a mediator between TGF beta receptors and TAK1. This protein can also interact with and activate the mitogen-activated protein kinase 14 (MAPK14/p38alpha), and thus represents an alternative activation pathway, in addition to the MAPKK pathways, which contributes to the biological responses of MAPK14 to various stimuli. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
• Locus ID: 10454