GAA (NM_001079804) Human 3' UTR Clone

CAT#: SC207459

3`UTR clone of glucosidase alpha; acid (GAA) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GAA
Synonyms LYAG
ACCN NM_001079804
Insert Size 575 bp
Sequence Data
>SC207459 3'UTR clone of NM_001079804
The sequence shown below is from the reference sequence of NM_001079804. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAGCAGTTTCTCGTCAGCTGGTGTTAGCCGGGCGGAGTGTGTTAGTCTCTCCAGAGGGAGGCTGGTTCCC
CAGGGAAGCAGAGCCTGTGTGCGGGCAGCAGCTGTGTGCGGGCCTGGGGGTTGCATGTGTCACCTGGAGC
TGGGCACTAACCATTCCAAGCCGCCGCATCGCTTGTTTCCACCTCCTGGGCCGGGGCTCTGGCCCCCAAC
GTGTCTAGGAGAGCTTTCTCCCTAGATCGCACTGTGGGCCGGGGCCCTGGAGGGCTGCTCTGTGTTAATA
AGATTGTAAGGTTTGCCCTCCTCACCTGTTGCCGGCATGCGGGTAGTATTAGCCACCCCCCTCCATCTGT
TCCCAGCACCGGAGAAGGGGGTGCTCAGGTGGAGGTGTGGGGTATGCACCTGAGCTCCTGCTTCGCGCCT
GCTGCTCTGCCCCAACGCGACCGCTGCCCGGCTGCCCAGAGGGCTGGATGCCTGCCGGTCCCCGAGCAAG
CCTGGGAACTCAGGAAAATTCACAGGACTTGGGAGATTCTAAATCTTAAGTGCAATTATTTTTAATAAAA
GGGGCATTTGGAATC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001079804.1
Summary 'This gene encodes lysosomal alpha-glucosidase, which is essential for the degradation of glycogen to glucose in lysosomes. The encoded preproprotein is proteolytically processed to generate multiple intermediate forms and the mature form of the enzyme. Defects in this gene are the cause of glycogen storage disease II, also known as Pompe's disease, which is an autosomal recessive disorder with a broad clinical spectrum. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]'
Locus ID 2548

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.