GAA (NM_000152) Human 3' UTR Clone

CAT#: SC207461

3`UTR clone of glucosidase alpha; acid (GAA) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GAA
• Synonyms: LYAG
• ACCN: NM_000152
• Insert Size: 575 bp
• Sequence Data:
  Insert Sequence

  >SC207461 3'UTR clone of NM_000152
  The sequence shown below is from the reference sequence of NM_000152. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGCAGTTTCTCGTCAGCTGGTGTTAGCCGGGCGGAGTGTGTTAGTCTCTCCAGAGGGAGGCTGGTTCCC
  CAGGGAAGCAGAGCCTGTGTGCGGGCAGCAGCTGTGTGCGGGCCTGGGGGTTGCATGTGTCACCTGGAGC
  TGGGCACTAACCATTCCAAGCCGCCGCATCGCTTGTTTCCACCTCCTGGGCCGGGGCTCTGGCCCCCAAC
  GTGTCTAGGAGAGCTTTCTCCCTAGATCGCACTGTGGGCCGGGGCCCTGGAGGGCTGCTCTGTGTTAATA
  AGATTGTAAGGTTTGCCCTCCTCACCTGTTGCCGGCATGCGGGTAGTATTAGCCACCCCCCTCCATCTGT
  TCCCAGCACCGGAGAAGGGGGTGCTCAGGTGGAGGTGTGGGGTATGCACCTGAGCTCCTGCTTCGCGCCT
  GCTGCTCTGCCCCAACGCGACCGCTGCCCGGCTGCCCAGAGGGCTGGATGCCTGCCGGTCCCCGAGCAAG
  CCTGGGAACTCAGGAAAATTCACAGGACTTGGGAGATTCTAAATCTTAAGTGCAATTATTTTTAATAAAA
  GGGGCATTTGGAATC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000152.3
• Summary: 'This gene encodes lysosomal alpha-glucosidase, which is essential for the degradation of glycogen to glucose in lysosomes. The encoded preproprotein is proteolytically processed to generate multiple intermediate forms and the mature form of the enzyme. Defects in this gene are the cause of glycogen storage disease II, also known as Pompe's disease, which is an autosomal recessive disorder with a broad clinical spectrum. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]'
• Locus ID: 2548