SEZ6L2 (NM_001114100) Human 3' UTR Clone

CAT#: SC207467

3`UTR clone of seizure related 6 homolog (mouse)-like 2 (SEZ6L2) transcript variant 4 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SEZ6L2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SEZ6L2
Synonyms BSRPA; PSK-1
ACCN NM_001114100
Insert Size 558
Sequence Data
>SC207467 3'UTR clone of NM_001114100
The sequence shown below is from the reference sequence of NM_001114100. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCGGGAGTATGAAGTTTCCATCTGAACCCCAAGACTACAGCTGCAGGACCCAGGACGCCCCTCCCCTCCT
CATTCGGGCAGAGGGAAATACGGGACCCGGTCTCTGCCTCCTGGCTGCCCTCCTCCCTGGCTGTGTAAAT
AGTCTCCCTATCCCACGAGGGGGCTTTGATGGCCCTGGAGATCCTACAGTAAATAAACCAGCATCCTGCC
GCCCAAAGCCGCCTCTTCTCAGTTGCCAAACGAGGGGCCTGCCCCCCGCCCTACCGGCTTTTGGATTCTG
GGAGGGGAACTCTGCCTCCCTGCAAATCTTGCAGCCCCTCCTGCCCAGGGCACCCCTCAAGGACTGCCCC
CGATAGCTCTACTGTTCCCTTGGCCACGAAGGTGCCCCCCTCCCAGATGCCCTGGCCCTAGGCCTGACTC
CGGCCAGGAGGGTCAGAAGAAGGACAAAGGGGAGAGCTGGGACAAGGCCTTGCCCCCTTCCTGCCATCTC
CCCAACCCACAGTCTCTCCACCTTTGCTTCTGAATTCTTGTTTTTGAGCAATAAACAGAAAATCGCCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001114100.1
Summary This gene encodes a seizure-related protein that is localized on the cell surface. The gene is located in a region of chromosome 16p11.2 that is thought to contain candidate genes for autism spectrum disorders (ASD), though there is no evidence directly implicating this gene in ASD. Increased expression of this gene has been found in lung cancers, and the protein is therefore considered to be a novel prognostic marker for lung cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Locus ID 26470

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.