SEZ6L2 (NM_201575) Human 3' UTR Clone

CAT#: SC207468

3`UTR clone of seizure related 6 homolog (mouse)-like 2 (SEZ6L2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SEZ6L2
• Synonyms: BSRPA; PSK-1
• ACCN: NM_201575
• Insert Size: 558
• Sequence Data:
  Insert Sequence

  >SC207468 3'UTR clone of NM_201575
  The sequence shown below is from the reference sequence of NM_201575. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCGGGAGTATGAAGTTTCCATCTGAACCCCAAGACTACAGCTGCAGGACCCAGGACGCCCCTCCCCTCCT
  CATTCGGGCAGAGGGAAATACGGGACCCGGTCTCTGCCTCCTGGCTGCCCTCCTCCCTGGCTGTGTAAAT
  AGTCTCCCTATCCCACGAGGGGGCTTTGATGGCCCTGGAGATCCTACAGTAAATAAACCAGCATCCTGCC
  GCCCAAAGCCGCCTCTTCTCAGTTGCCAAACGAGGGGCCTGCCCCCCGCCCTACCGGCTTTTGGATTCTG
  GGAGGGGAACTCTGCCTCCCTGCAAATCTTGCAGCCCCTCCTGCCCAGGGCACCCCTCAAGGACTGCCCC
  CGATAGCTCTACTGTTCCCTTGGCCACGAAGGTGCCCCCCTCCCAGATGCCCTGGCCCTAGGCCTGACTC
  CGGCCAGGAGGGTCAGAAGAAGGACAAAGGGGAGAGCTGGGACAAGGCCTTGCCCCCTTCCTGCCATCTC
  CCCAACCCACAGTCTCTCCACCTTTGCTTCTGAATTCTTGTTTTTGAGCAATAAACAGAAAATCGCCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_201575.2
• Summary: This gene encodes a seizure-related protein that is localized on the cell surface. The gene is located in a region of chromosome 16p11.2 that is thought to contain candidate genes for autism spectrum disorders (ASD), though there is no evidence directly implicating this gene in ASD. Increased expression of this gene has been found in lung cancers, and the protein is therefore considered to be a novel prognostic marker for lung cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
• Locus ID: 26470