TWEAK (TNFSF12) (NM_003809) Human 3' UTR Clone

CAT#: SC207507

3`UTR clone of tumor necrosis factor (ligand) superfamily member 12 (TNFSF12) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TNFSF12
• Synonyms: APO3L; DR3LG; TNLG4A; TWEAK
• ACCN: NM_003809
• Insert Size: 554
• Sequence Data:
  Insert Sequence

  >SC207507 3'UTR clone of NM_003809
  The sequence shown below is from the reference sequence of NM_003809. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCCTCACCTACTTCGGACTCTTCCAGGTTCACTGAGGGGCCCTGGTCTCCCCGCAGTCGTCCCAGGCTG
  CCGGCTCCCCTCGACAGCTCTCTGGGCACCCGGTCCCCTCTGCCCCACCCTCAGCCGCTCTTTGCTCCAG
  ACCTGCCCCTCCCTCTAGAGGCTGCCTGGGCCTGTTCACGTGTTTTCCATCCCACATAAATACAGTATTC
  CCACTCTTATCTTACAACTCCCCCACCGCCCACTCTCCACCTCACTAGCTCCCCAATCCCTGACCCTTTG
  AGGCCCCCAGTGATCTCGACTCCCCCCTGGCCACAGACCCCCAGGGCATTGTGTTCACTGTACTCTGTGG
  GCAAGGATGGGTCCAGAAGACCCCACTTCAGGCACTAAGAGGGGCTGGACCTGGCGGCAGGAAGCCAAAG
  AGACTGGGCCTAGGCCAGGAGTTCCCAAATGTGAGGGGCGAGAAACAAGACAAGCTCCTCCCTTGAGAAT
  TCCCTGTGGATTTTTAAAACAGATATTATTTTTATTATTATTGTGACAAAATGTTGATAAATGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003809.2
• Summary: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is a ligand for the FN14/TWEAKR receptor. This cytokine has overlapping signaling functions with TNF, but displays a much wider tissue distribution. This cytokine, which exists in both membrane-bound and secreted forms, can induce apoptosis via multiple pathways of cell death in a cell type-specific manner. This cytokine is also found to promote proliferation and migration of endothelial cells, and thus acts as a regulator of angiogenesis. Alternative splicing results in multiple transcript variants. Some transcripts skip the last exon of this gene and continue into the second exon of the neighboring TNFSF13 gene; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010]
• Locus ID: 8742