PANK2 (NM_024960) Human 3' UTR Clone

CAT#: SC207514

3`UTR clone of pantothenate kinase 2 (PANK2) transcript variant 3 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PANK2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PANK2
Synonyms C20orf48; HARP; HSS; NBIA1; PKAN
ACCN NM_024960
Insert Size 595
Sequence Data
>SC207514 3'UTR clone of NM_024960
The sequence shown below is from the reference sequence of NM_024960. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTGGAGCACTCCTTGAGCTGTTGAAGATCCCGTGATCATTACCTGGGGAGGGGTTCCTGAAACCTTCCAC
AATGGGATCTGTGGACTTTCATTTTTTTAAGAGACTTACTCAATTTCATGACTGTACTACCTGAAACAAA
GTGAGAAAGGACAGGTGTATTTTTCTAAGTCATCAAGATAAATCCTTAAGAATTCAGTCTAAATTAGCAA
CCAGGAAGGAAAAATATATTAAAAACAACAAAAAAGTGGCACATGTCCAGGCAGTGTGAGGATTTGCTGT
ATATAAGTTGCCTGCTTTGTATTTTTGAAATCTCTGCATCACTCATTGGAAGTGCTTCTGAAGAGAGCTG
CTCTGTGTTCAGTTGACTGGTTTTGTGTCCTGTTTGAACTTGCTGAATGTAAGGCAGGCTACTATGCGTT
ATAATCTAATCACAATTTGTCAATATGGTCTTGGCAATCATCTGTGCATTACTCTGGTTTGCATTAAGCC
TGTGTGTGAACTTACTGTAAAACATGTTTTATTTCAAGGTTCTGCAAAATTAATTGGGCAGGTTAATTGT
GTACCTGAAACTTAACAAGCAGTTTTTGGAAGGGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024960.4
Summary This gene encodes a protein belonging to the pantothenate kinase family and is the only member of that family to be expressed in mitochondria. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by acyl CoA species. Mutations in this gene are associated with HARP syndrome and pantothenate kinase-associated neurodegeneration (PKAN), formerly Hallervorden-Spatz syndrome. Alternative splicing, involving the use of alternate first exons, results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
Locus ID 80025

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.