PANK2 (NM_153638) Human 3' UTR Clone

CAT#: SC207515

3`UTR clone of pantothenate kinase 2 (PANK2) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PANK2
• Synonyms: C20orf48; HARP; HSS; NBIA1; PKAN
• ACCN: NM_153638
• Insert Size: 595
• Sequence Data:
  Insert Sequence

  >SC207515 3'UTR clone of NM_153638
  The sequence shown below is from the reference sequence of NM_153638. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTGGAGCACTCCTTGAGCTGTTGAAGATCCCGTGATCATTACCTGGGGAGGGGTTCCTGAAACCTTCCAC
  AATGGGATCTGTGGACTTTCATTTTTTTAAGAGACTTACTCAATTTCATGACTGTACTACCTGAAACAAA
  GTGAGAAAGGACAGGTGTATTTTTCTAAGTCATCAAGATAAATCCTTAAGAATTCAGTCTAAATTAGCAA
  CCAGGAAGGAAAAATATATTAAAAACAACAAAAAAGTGGCACATGTCCAGGCAGTGTGAGGATTTGCTGT
  ATATAAGTTGCCTGCTTTGTATTTTTGAAATCTCTGCATCACTCATTGGAAGTGCTTCTGAAGAGAGCTG
  CTCTGTGTTCAGTTGACTGGTTTTGTGTCCTGTTTGAACTTGCTGAATGTAAGGCAGGCTACTATGCGTT
  ATAATCTAATCACAATTTGTCAATATGGTCTTGGCAATCATCTGTGCATTACTCTGGTTTGCATTAAGCC
  TGTGTGTGAACTTACTGTAAAACATGTTTTATTTCAAGGTTCTGCAAAATTAATTGGGCAGGTTAATTGT
  GTACCTGAAACTTAACAAGCAGTTTTTGGAAGGGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_153638.2
• Summary: This gene encodes a protein belonging to the pantothenate kinase family and is the only member of that family to be expressed in mitochondria. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by acyl CoA species. Mutations in this gene are associated with HARP syndrome and pantothenate kinase-associated neurodegeneration (PKAN), formerly Hallervorden-Spatz syndrome. Alternative splicing, involving the use of alternate first exons, results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
• Locus ID: 80025