Calpain 3 (CAPN3) (NM_173088) Human 3' UTR Clone

CAT#: SC207531

3`UTR clone of calpain 3 (p94) (CAPN3) transcript variant 4 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CAPN3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CAPN3
Synonyms CANP3; CANPL3; LGMD2; LGMD2A; LGMDD4; LGMDR1; nCL-1; p94
ACCN NM_173088
Insert Size 563 bp
Sequence Data
>SC207531 3'UTR clone of NM_173088
The sequence shown below is from the reference sequence of NM_173088. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGCTCACCATGTATGCCTGAACCAGGCTGGCCTCATCCAAAGCCATGCAGGATCACTCAGGATTTCAGTT
TCACCCTCTATTTCCAAAGCCATTTACCTCAAAGGACCCAGCAGCTACACCCCTACAGGCTTCCAGGCAC
CTCATCAGTCATGCTCCTCCTCCATTTTACCCCCTACCCATCCTTGATCGGTCATGCCTAGCCTGACCCT
TTAGTAAAGCAATGAGGTAGGAAGAACAAACCCTTGTCCCTTTGCCATGTGGAGGAAAGTGCCTGCCTCT
GGTCCGAGCCGCCTCGGTTCTGAAGCGAGTGCTCCTGCTTACCTTGCTCTAGGCTGTCTGCAGAAGCACC
TGCCGGTGGCACTCAGCACCTCCTTGTGCTAGAGCCCTCCATCACCTTCACGCTGTCCCACCATGGGCCA
GGAACCAAACCAGCACTGGGTTCTACTGCTGTGGGGTAAACTAACTCAGTGGAATAGGGCTGGTTACTTT
GGGCTGTCCAACTCATAAGTTTGGCTGCATTTTGAAAAAAGCTGATCTAAATAAAGGCATGTGTATGGCT
GGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_173088.1
Summary 'Calpain, a heterodimer consisting of a large and a small subunit, is a major intracellular protease, although its function has not been well established. This gene encodes a muscle-specific member of the calpain large subunit family that specifically binds to titin. Mutations in this gene are associated with limb-girdle muscular dystrophies type 2A. Alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms and some variants are ubiquitously expressed. [provided by RefSeq, Jul 2008]'
Locus ID 825

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.