RPB11 (POLR2J) (NM_006234) Human 3' UTR Clone

CAT#: SC207539

3`UTR clone of polymerase (RNA) II (DNA directed) polypeptide J 13.3kDa (POLR2J) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "POLR2J"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol POLR2J
Synonyms hRPB14; POLR2J1; RPB11; RPB11A; RPB11m
ACCN NM_006234
Insert Size 562 bp
Sequence Data
>SC207539 3'UTR clone of NM_006234
The sequence shown below is from the reference sequence of NM_006234. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCCATAAAAGACAAGCAGGAAGGAATTGAGTAGGGGCCAGAGGGGGCTCTGCTCGGCCTGTGAGCCCCGT
TCCTACCTGTGCCTGACCCTCCGCTCCAGGTACCACACCGAGGAGAGCGGCCGGTCCCAGCCATGGCCCG
CCTTGTGGCCACCCCTCACCCTGACACCGACGTGTCCTGTACATAGATTAGGTTTTATATTCCTAATAAA
GTATAGCGGGAGAGACCTGGATGTGGACTTGAGCAGCGGTGACTTCGCAAGCAAATGGATTGTCAGGCTT
GATGCAGGCAGATGACCTGTTTCAGGGGCGTCCGGCTGGCAGGGATGAATTCATTCTGGACCAAAGATCC
GGGGTCCAGGGGCTGCTGCGGGGGCTGTGCTGAGCCGGAGAGAAGTGTGCAAACCCATGAGCTCCCAAGA
GTCTCTGCTCTAGAAGCCTCAACTCCTGGGCCTGCCTGTCAGTCAAAGCAGGAACACTTCTTCCTGCATA
ACTCGAAACACCTTTCCACAGGCTTCTTGTCCACAGTAGAGTTTAATAAAAATATTCACTGAAAGACCCC
CC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006234.4
Summary 'This gene encodes a subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene exists as a heterodimer with another polymerase subunit; together they form a core subassembly unit of the polymerase. Two similar genes are located nearby on chromosome 7q22.1 and a pseudogene is found on chromosome 7p13. [provided by RefSeq, Jul 2008]'
Locus ID 5439

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.